Previous Contig 011547:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010B20Sequence263005130 (3)gb:AP006067_18608412e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P056746011547 (2)gb:AY062550_15652062e-31Arabidopsis thaliana putative protein (At4g36050; T19K4.180) mRNA, complete cds.
JMSF012H01Sequence263005130 (3)pir|T05497|T054971e-24hypothetical protein T19K4.180 - Arabidopsis thaliana>gb:ATCHRIV84_1547565 Arabi786011547 (2)gb:AY062550_15652064e-36Arabidopsis thaliana putative protein (At4g36050; T19K4.180) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012H01+ CAGGA
                      ____________________________________________________________
consensus CAGGA
 
. : . : . : . : . : . :
rJMSF012H01+ TAGTCCCATATCAAGATTAGAGGAGAGCTATGAGTGCTCCTCAAGTAAAGATTCTCACAT
                      ____________________________________________________________
consensus TAGTCCCATATCAAGATTAGAGGAGAGCTATGAGTGCTCCTCAAGTAAAGATTCTCACAT
 
. : . : . : . : . : . :
rJMSF012H01+ GGCAATGCATAGTTTAGGAAGCACTGCTAATTTATTGCCTTGCTCAGAAAGCAAGAAAAG
                      ____________________________________________________________
consensus GGCAATGCATAGTTTAGGAAGCACTGCTAATTTATTGCCTTGCTCAGAAAGCAAGAAAAG
 
. : . : . : . : . : . :
rJMSF012H01+ AGCACGAGACAGTCGGGGGTCTCAGCTCACACTAAAGTCATTCTTCCAGAAAGCTTCAAG
rJMSF010B20+ AAGTCATTNTTCCAGAAAGCTTCAAG
                      ____________________________________________________________
consensus AGCACGAGACAGTCGGGGGTCTCAGCTCACACTAAAGTCATTCTTCCAGAAAGCTTCAAG
 
. : . : . : . : . : . :
rJMSF012H01+ TGAAAGTGAAACTTTAGATAACAATTGTGTGGTCAACAAGCATAATCAGAAGGATATGTC
rJMSF010B20+ TGAAAGTGAAACTTTAGATAACAATTGTGTGGTCAACAAGCATAATCAGAAGGATATGTC
                      ____________________________________________________________
consensus TGAAAGTGAAACTTTAGATAACAATTGTGTGGTCAACAAGCATAATCAGAAGGATATGTC
 
. : . : . : . : . : . :
rJMSF012H01+ TAATTCCCTTTCAAATTTATATGGTGATAATGCTGCTGAAAATGGTAACCGTAACACAGA
rJMSF010B20+ TAATTCCCTTTCAAATTTATATGGTGATAATGCTGCTGAAAATGGTAACCGTAACACAGA
                      ____________________________________________________________
consensus TAATTCCCTTTCAAATTTATATGGTGATAATGCTGCTGAAAATGGTAACCGTAACACAGA
 
. : . : . : . : . : . :
rJMSF012H01+ GAATGCATCTGCTCAGGAGGTAGGTATGCTAGATGCATGCAACTCTTCAGACAAAGAGAA
rJMSF010B20+ GAATGCATCTGCTCAGGAGGTAGGTATGCTAGATGCATGCAACTCTTCAGACAAAGAGAA
                      ____________________________________________________________
consensus GAATGCATCTGCTCAGGAGGTAGGTATGCTAGATGCATGCAACTCTTCAGACAAAGAGAA
 
. : . : . : . : . : . :
rJMSF012H01+ GAGGGCTGATGCATTGCAGGAGTGGCAGAGGATTCAACAATTTATGCAGAATAGTGTACC
rJMSF010B20+ GAGGGCTGATGCATTGCAGGAGTGGCAGAGGATTCAACAATTTATGCAGAATAGTGTACC
                      ____________________________________________________________
consensus GAGGGCTGATGCATTGCAGGAGTGGCAGAGGATTCAACAATTTATGCAGAATAGTGTACC
 
. : . : . : . : . : . :
rJMSF012H01+ ACTTTGTAGGGGCCATAAGGAGCCTTGCGTTTCTAGGCTTGTTAAGAAACCAGGCCCCAA
rJMSF010B20+ ACTTTGTAGGGGCCATAAGGAGCCTTGCGTTTCTAGGCTTGTTAAGAAACCAGGCCCCAA
                      ____________________________________________________________
consensus ACTTTGTAGGGGCCATAAGGAGCCTTGCGTTTCTAGGCTTGTTAAGAAACCAGGCCCCAA
 
. : . : . : . : . : . :
rJMSF012H01+ TTTGGGACGCAGGTTTTATGTCTGCGCTCGTGCTGAGGGACCTGCATCTAACCCTGAAGC
rJMSF010B20+ TTTGGGACGCAGGTTTTATGTCTGCGCTCGTGCTGAGGGACCTGCATCTAACCCTGAAGC
                      ____________________________________________________________
consensus TTTGGGACGCAGGTTTTATGTCTGCGCTCGTGCTGAGGGACCTGCATCTAACCCTGAAGC
 
. : . : . : . : . : . :
rJMSF012H01+ AAATTGTGGTTACTTTAAGTGGGCTGCTTCAAAACCCAAGGGCAAAAACTAGCAGTATTT
rJMSF010B20+ AAATTGTGGTTACTTTAAGTGGGCTGCTTCAAAACCCAAGGGCAAAAACTAGCAGTATTT
                      ____________________________________________________________
consensus AAATTGTGGTTACTTTAAGTGGGCTGCTTCAAAACCCAAGGGCAAAAACTAGCAGTATTT
 
. : . : . : . : . : . :
rJMSF012H01+ GCTTCCATACGAGACAAACGACCATGAAAGGCATCTAAACGTAGTGCCTTCAAATTTCAG
rJMSF010B20+ GCTTCCATACGAGACAAACGACCATGAAAGGCATCTAAACGTAGTGCCTTCAAATTTCAG
                      ____________________________________________________________
consensus GCTTCCATACGAGACAAACGACCATGAAAGGCATCTAAACGTAGTGCCTTCAAATTTCAG
 
. : . : . : . : . : . :
rJMSF010B20+ GTCAGTAAAATTAAGAAATCTTCTCTCTAGACTCTATAGCAACACCCCTCTTTGAGTTTT
                      ____________________________________________________________
consensus GTCAGTAAAATTAAGAAATCTTCTCTCTAGACTCTATAGCAACACCCCTCTTTGAGTTTT
 
. : . : . : . : . : . :
rJMSF010B20+ ATTAATGTTTTTCTTCATGTATCTACCTTTTCTATAGCTAATTGCCATTTGCATTTTTTG
                      ____________________________________________________________
consensus ATTAATGTTTTTCTTCATGTATCTACCTTTTCTATAGCTAATTGCCATTTGCATTTTTTG
 
. : . : . : . : . : . :
rJMSF010B20+ TAAATATTTTCTAACCCCATATATTAGCCTTAAGGCAAGTTTCTGTGATTGAATTCGTAT
                      ____________________________________________________________
consensus TAAATATTTTCTAACCCCATATATTAGCCTTAAGGCAAGTTTCTGTGATTGAATTCGTAT
 
. : . : . : . : . : . :
rJMSF010B20+ TTTGTCAAAACGGGCTCATTTTAGAGAAATACCCTGAGCTTGATGTAAGGAAAAACCTTT
                      ____________________________________________________________
consensus TTTGTCAAAACGGGCTCATTTTAGAGAAATACCCTGAGCTTGATGTAAGGAAAAACCTTT