Previous Contig 011536:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS158D03Sequence504011536 (3)gb:AY510449_16103494e-76Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.
JMSF009O03Sequence292002839 (9)gb:AY510449_16103493e-09Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.745011536 (3)gb:AY510449_16103493e-79Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.
JMSF011L24Sequence310002839 (9)gb:AY510449_16103492e-24Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.747011536 (3)gb:AY510449_16103499e-80Solanum tuberosum 4-alpha-glucanotransferase (DE2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF011L24+ CTNGGCATGATTCCCGCNTGCGTTCATC
JMFS158D03- TGCGTTCATC
rJMSF009O03+ GGCATGATTCCCGCTTGCGTTCATC
                      ____________________________________________________________
consensus CTNGGCATGATTCCCGCTTGCGTTCATC
 
. : . : . : . : . : . :
rJMSF011L24+ CTGTGATGGAAGAGTTGGGCTTAATAGGCTTACGGATTCAGCGCATGCCAAGTGATTCCG
JMFS158D03- CTGTGATGGAAGAGTGGGGCTTAATAGGCTTACGGATTCAGCGCATGCCAAGTGATTCCG
rJMSF009O03+ CTGTGATGGAAGAGTTGGGCTTAATAGGCTTACGGATTCAGCGCATGCCAAGTGATTCCG
                      ____________________________________________________________
consensus CTGTGATGGAAGAGTTGGGCTTAATAGGCTTACGGATTCAGCGCATGCCAAGTGATTCCG
 
. : . : . : . : . : . :
rJMSF011L24+ GAGTGGAATTCGGTATTCCTTCTACATACCCCTATATGACGGTATGTGCTCCATCTTGCC
JMFS158D03- GAGTGGAATTCGGTATTCCTTCTACATACCCCTATATGACGGTATGTGCTCCATCTTGCC
rJMSF009O03+ GAGTGGAATTCGGTATTCCTTCTACATACCCCTATATGACGGTATGTGCTCCATCTTGCC
                      ____________________________________________________________
consensus GAGTGGAATTCGGTATTCCTTCTACATACCCCTATATGACGGTATGTGCTCCATCTTGCC
 
. : . : . : . : . : . :
rJMSF011L24+ ATGACTGCTCCACTCTGCGCGCCTGGTGGGAAGAAGATGACGAAAGAAGGCGTCGCTTTT
JMFS158D03- ATGACTGCTCCACTCTGCGCGCCTGGTGGGAAGAAGATGACGAAAGAAGGCGTCGCTTTT
rJMSF009O03+ ATGACTGCTCCACTCTGCGCGCCTGGTGGGAAGAAGATGACGAAAGAAGGCGTCGCTTTT
                      ____________________________________________________________
consensus ATGACTGCTCCACTCTGCGCGCCTGGTGGGAAGAAGATGACGAAAGAAGGCGTCGCTTTT
 
. : . : . : . : . : . :
rJMSF011L24+ TTCAAACAGTCGTGGGGTCCGATGATTTGCCTCCTGATCAATGTACTCCTGAAATTGTCT
JMFS158D03- TTCAAACAGTCGTGGGGTCCGATGATTTGCCTCCTGATCAATGTACTCCTGAAATTGTCT
rJMSF009O03+ TTCAAACAGTCGTGGGGTCCGATGATTTGCCTCCTGATCAATGTACTCCTGAAATTGTCT
                      ____________________________________________________________
consensus TTCAAACAGTCGTGGGGTCCGATGATTTGCCTCCTGATCAATGTACTCCTGAAATTGTCT
 
. : . : . : . : . : . :
rJMSF011L24+ ACTTCGTCTTGCATCAGCATTTCGAGTCCCCATCGATGTGGTCAATCTTTCCTCTCCAGG
JMFS158D03- ACTTCGTCTTGCATCAGCATTTCGAGTCCCCATCGATGTGGTCAATCTTTCCTCTCCAGG
rJMSF009O03+ ACTTCGTCTTGCATCAGCATTTCGAGTCCCCATCGATGTGGTCAATCTTTCCTCTCCAGG
                      ____________________________________________________________
consensus ACTTCGTCTTGCATCAGCATTTCGAGTCCCCATCGATGTGGTCAATCTTTCCTCTCCAGG
 
. : . : . : . : . : . :
rJMSF011L24+ ATTTGCTAGCACTCAAAGAAGCCTATACAACCCGCCCTGCAGTGGAGGAGACGATAAACG
JMFS158D03- ATTTGCTAGCACTCAAAGAAGCCTATACAACCCGCCCTGCAGTGGAGGAGACGATAAACG
rJMSF009O03+ ATTTGCTAGCACTCAAAGAAGCCTATACAACCCGCCCTGCAGTGGAGGAGACGATAAACG
                      ____________________________________________________________
consensus ATTTGCTAGCACTCAAAGAAGCCTATACAACCCGCCCTGCAGTGGAGGAGACGATAAACG
 
. : . : . : . : . : . :
rJMSF011L24+ ACCCAACAAATCCAAAACACTACTGGCAATATCGTGTACACGTGACAATGGAGTCCTTGC
JMFS158D03- ACCCAACAAATCCAAAACACTACTGGCAATATCGTGTACACGTGACAATGGAGTCCTTGC
rJMSF009O03+ ACCCAACAAATCCAAAACACTACTGGCAATATCGTGTACACGTGACAATGGAGTCCTTGC
                      ____________________________________________________________
consensus ACCCAACAAATCCAAAACACTACTGGCAATATCGTGTACACGTGACAATGGAGTCCTTGC
 
. : . : . : . : . : . :
rJMSF011L24+ TCAAAGATAAAGAGCTGACGGGTATCATCAAAAATCTCGTCCATGGGAGCGGGAGATCTT
JMFS158D03- TCAAAGATAAAGAGCTGACGGGTATCATCAAAAATCTCGTCCATGGGAGCGGGAGATCTT
rJMSF009O03+ TCAAAGATAAAGAGCTGACGGGTATCATCAAAAATCTCGTCCATGGGAGCGGGAGATCTT
                      ____________________________________________________________
consensus TCAAAGATAAAGAGCTGACGGGTATCATCAAAAATCTCGTCCATGGGAGCGGGAGATCTT
 
. : . : . : . : . : . :
rJMSF011L24+ ATCCGGGAAGGCTGCAGGATGTTGCTAGCGATCAAGGGAAAAGTGTTCCCTTGGCAGGGT
JMFS158D03- ATCCGGGAAGG
rJMSF009O03+ ATCCGGGAAGGCTGCAGGATGTTGCTAGCGATCAAGGGAAAAGTGTTCCCTTGGCAGGGT
                      ____________________________________________________________
consensus ATCCGGGAAGGCTGCAGGATGTTGCTAGCGATCAAGGGAAAAGTGTTCCCTTGGCAGGGT
 
. : . : . : . : . : . :
rJMSF011L24+ AGGGAAGTGGAGTTTCCCAGAAAGAAATAGCAGCAGTCTAATGAGGTTGATATTGCTTTT
rJMSF009O03+ AGGGAAGTGGAGTTTCCCAGAAAGAAATAGCAGCAGTCTAATGAGGTTGATATTGCTTTT
                      ____________________________________________________________
consensus AGGGAAGTGGAGTTTCCCAGAAAGAAATAGCAGCAGTCTAATGAGGTTGATATTGCTTTT
 
. : . : . : . : . : . :
rJMSF011L24+ ATTCCACTTCTAGATAGTAAATTATGCAGGACTGGCAATTGCTACTTTTACATTTTATGG
rJMSF009O03+ ATTCCACTTCTAGATAGTAAATTATGCAGGACTGGCAATTGCTACTTTTACATTTTATGG
                      ____________________________________________________________
consensus ATTCCACTTCTAGATAGTAAATTATGCAGGACTGGCAATTGCTACTTTTACATTTTATGG
 
. : . : . : . : . : . :
rJMSF011L24+ TAGATTTCATGCTATTTATGTTGCTGTCATACACTGTAATCTGAATAATGATTATACAT
rJMSF009O03+ TAGATTTCATGCTATTTATGTTGCTGTCATACACTGTAATCTGAATAATGATTATACATT
                      ____________________________________________________________
consensus TAGATTTCATGCTATTTATGTTGCTGTCATACACTGTAATCTGAATAATGATTATACATT