Previous Contig 011535:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009O01Sequence293011535 (2)pir|T00560|T005607e-15hypothetical protein At2g39500 [imported] - Arabidopsis thaliana>gb:AC004218_153638011535 (2)pir|T00560|T005602e-14hypothetical protein At2g39500 [imported] - Arabidopsis thaliana>gb:AC004218_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF009O01- GGAATACGGATTCCGATCAAAATCGGATCTATTTGCGC
rJMSF009O01+ GGAATACGGATTCCGATCAAAATCGGATCTATTTGCGC
                      ____________________________________________________________
consensus GGAATACGGATTCCGATCAAAATCGGATCTATTTGCGC
 
. : . : . : . : . : . :
JMSF009O01- GCACATTCCTAGGGTTAGGGTTTTAGATTTCGCAATGGAAACCAGGAAATTCCAAGTAAA
rJMSF009O01+ GCACATTCCTAGGGTTAGGGTTTTAGATTTCGCAATGGAAACCAGGAAATTCCAAGTAAA
                      ____________________________________________________________
consensus GCACATTCCTAGGGTTAGGGTTTTAGATTTCGCAATGGAAACCAGGAAATTCCAAGTAAA
 
. : . : . : . : . : . :
JMSF009O01- AGACCTCCTCAAAGACAAAAAGTTCTGGTTCGCCTCTATCCTAATCGCATGGGCCGCTGG
rJMSF009O01+ AGACCTCCTCAAAGACAAAAAGTTCTGGTTCGCCTCTATCCTAATCGCATGGGCCGCTGG
                      ____________________________________________________________
consensus AGACCTCCTCAAAGACAAAAAGTTCTGGTTCGCCTCTATCCTAATCGCATGGGCCGCTGG
 
. : . : . : . : . : . :
JMSF009O01- TCTCCAGGGGCATATGATGTGGTTACAGAGGCAGGATTCCTTCAAGCAGAAATTCGGAAA
rJMSF009O01+ TCTCCAGGGGCATATGATGTGGTTACAGAGGCAGGATTCCTTCAAGCAGAAATTCGGAAA
                      ____________________________________________________________
consensus TCTCCAGGGGCATATGATGTGGTTACAGAGGCAGGATTCCTTCAAGCAGAAATTCGGAAA
 
. : . : . : . : . : . :
JMSF009O01- TGTAAACAATGAAGGGGCTGAGAATCAGTGATCAAGTGGAGAACCCTATAAGGAATTTGA
rJMSF009O01+ TGTAAACAATGAAGGGGCTGAGAATCAGTGATCAAGTGGAGAACCCTATAAGGAATTTGA
                      ____________________________________________________________
consensus TGTAAACAATGAAGGGGCTGAGAATCAGTGATCAAGTGGAGAACCCTATAAGGAATTTGA
 
. : . : . : . : . : . :
JMSF009O01- GATTTGACTGTAAAA
rJMSF009O01+ GATTTGACTGTAAAAAGAAGATGAACAAACATCAACGGGGTGCATCTTTATGCTAGTTTT
                      ____________________________________________________________
consensus GATTTGACTGTAAAAAGAAGATGAACAAACATCAACGGGGTGCATCTTTATGCTAGTTTT
 
. : . : . : . : . : . :
rJMSF009O01+ TATACGTTTTTTGAATCATTCATTGAAGTGAATAAAGTTGTGCTACGAATTAGTGAGGAT
                      ____________________________________________________________
consensus TATACGTTTTTTGAATCATTCATTGAAGTGAATAAAGTTGTGCTACGAATTAGTGAGGAT
 
. : . : . : . : . : . :
rJMSF009O01+ TATGCAGCTGTGGGATTGCTTTACTTCTTGATTCACTAATGAATTGGTGCAACATACAGC
                      ____________________________________________________________
consensus TATGCAGCTGTGGGATTGCTTTACTTCTTGATTCACTAATGAATTGGTGCAACATACAGC
 
. : . : . : . : . : . :
rJMSF009O01+ TTGTGTGTGTGTTTATTTTATTTTTCTGTGGTCAAATTAACTTCTGCTTGTGCTAGAATT
                      ____________________________________________________________
consensus TTGTGTGTGTGTTTATTTTATTTTTCTGTGGTCAAATTAACTTCTGCTTGTGCTAGAATT
 
. : . : . : . : . : . :
rJMSF009O01+ CTGCAGCCTGCTGATGGATGTAGAATAATATAGTCTGAATTGTTTTGTTGATAACTCTAA
                      ____________________________________________________________
consensus CTGCAGCCTGCTGATGGATGTAGAATAATATAGTCTGAATTGTTTTGTTGATAACTCTAA
 
. : . : . : . : . : . :
rJMSF009O01+ TCTCTTCTTCAATGCTTAGAAAAAGTTGAGAATTCTTGTACTTGCTCTTGTTAATTGCCT
                      ____________________________________________________________
consensus TCTCTTCTTCAATGCTTAGAAAAAGTTGAGAATTCTTGTACTTGCTCTTGTTAATTGCCT