Previous Contig 011532:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004M20Sequence307011532 (4)gb:AP003803_18335973e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10364011532 (4)gb:AY086840_15718821e-15Arabidopsis thaliana clone 28455 mRNA, complete sequence.
JMSF009M15Sequence258011532 (4)gb:AP003803_18335975e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10734011532 (4)gb:AP003803_18335971e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF009M15- GGGAAGAAGAGAGATTGATTCATTTTTGCTTAGCGACTGTT
                      ____________________________________________________________
consensus GGGAAGAAGAGAGATTGATTCATTTTTGCTTAGCGACTGTT
 
. : . : . : . : . : . :
JMSF009M15- CTCGCGTCAGCGAAAAATGGCGAGTAGCACTCTGCAACGATTAGCTAGGCGTTCGCACCA
                      ____________________________________________________________
consensus CTCGCGTCAGCGAAAAATGGCGAGTAGCACTCTGCAACGATTAGCTAGGCGTTCGCACCA
 
. : . : . : . : . : . :
JMSF009M15- GGCTTATGGAGTCTCGGTGACGCCGCTATCCAGAGCATTCTCTGCTTCTTCCTCGGACTC
                      ____________________________________________________________
consensus GGCTTATGGAGTCTCGGTGACGCCGCTATCCAGAGCATTCTCTGCTTCTTCCTCGGACTC
 
. : . : . : . : . : . :
JMSF009M15- GTTGGTGGAGATCCAGCGCGGAGAGGTCGGTATGGTCTCCGGTATTCCCCAAGAGCATCT
JMSF004M20- GAGATCCAGCGCGGAGAGGTCGGTATGGTCTCCGGTATTCCCCAAGAGCATCT
rJMSF009M15+ GAGATCCAGCGCGGAGAGGTCGGTATGGTCTCCGGTATTCCCCAAGAGCATCT
                      ____________________________________________________________
consensus GTTGGTGGAGATCCAGCGCGGAGAGGTCGGTATGGTCTCCGGTATTCCCCAAGAGCATCT
 
. : . : . : . : . : . :
JMSF009M15- CCGCAGGAAGGTTATTATTTTCTCACCTGC
JMSF004M20- CCGCAGGAAGGTTATTATTTTCTCACCTGCTCGTACAGCTAGTCAGCAAGGATCTGGAAA
rJMSF009M15+ CCGCAGGAAGGTTATTATTTTCTCACCTGCTCGTACAGCTAGTCAGCAAGGATCTGGAAA
                      ____________________________________________________________
consensus CCGCAGGAAGGTTATTATTTTCTCACCTGCTCGTACAGCTAGTCAGCAAGGATCTGGAAA
 
. : . : . : . : . : . :
JMSF004M20- AGTTGGAAGATGGAAAAT
rJMSF009M15+ AGTTGGAAGATGGAAAATAAATTTTTTGTCAACACAGAAATGGGAAAATCCACTGATGGG
                      ____________________________________________________________
consensus AGTTGGAAGATGGAAAATAAATTTTTTGTCAACACAGAAATGGGAAAATCCACTGATGGG
 
. : . : . : . : . : . :
rJMSF004M20+ AATGTTGGTGATGCTGCGCTTACTTTTGACAG
rJMSF009M15+ CTGGACATCCACAGGGGACCCATATGCGAATGTTGGTGATGCTGCGCTTACTTTTGACAG
                      ____________________________________________________________
consensus CTGGACATCCACAGGGGACCCATATGCGAATGTTGGTGATGCTGCGCTTACTTTTGACAG
 
. : . : . : . : . : . :
rJMSF004M20+ TGAAGAAGCTGCAAAAGCATTTGCTGAAAGACANGGCTGGGAGTATACGGNGAAGAAGCC
rJMSF009M15+ TGAAGAAGCTGCAAAAGCATTTGCTGAAAGACATGGCTGGGAGTATACGGTGAAGAAGCC
                      ____________________________________________________________
consensus TGAAGAAGCTGCAAAAGCATTTGCTGAAAGACATGGCTGGGAGTATACGGTGAAGAAGCC
 
. : . : . : . : . : . :
rJMSF004M20+ TCACACACCATTGTTAANGATCAANTCCTATGCAGNCAATTTCAAGTGGAAGGGCCNTCN
rJMSF009M15+ TCACACACCATTGTTAAAGATCAAATCCTATGCAGACAATTTCAAGTGGAAGGGCCCTCC
                      ____________________________________________________________
consensus TCACACACCATTGTTAAAGATCAAATCCTATGCAGACAATTTCAAGTGGAAGGGCCCTCC
 
. : . : . : . : . : . :
rJMSF004M20+ TAAAACAGAAGGATGAATTATTTCTATTCTTGCTCTCTTGAAGTTCTAACCCTTTGGGTC
rJMSF009M15+ TAAAACAGAAGGATGAATTATTTCTATTCTTGCTCTCTTGAAGTTCTAACCCTTTGGGTC
                      ____________________________________________________________
consensus TAAAACAGAAGGATGAATTATTTCTATTCTTGCTCTCTTGAAGTTCTAACCCTTTGGGTC
 
. : . : . : . : . : . :
rJMSF004M20+ CNTAAATTACTACAGCCTNTGGATCCNGTTTGTTTACCTTNTGAAGTCTCAATGCACTAT
rJMSF009M15+ CATAAATTACTACAGCCTTTGGATCCTGTTTGTTTACCTTTTGAAGTCTCAATGCACTAT
                      ____________________________________________________________
consensus CATAAATTACTACAGCCTTTGGATCCTGTTTGTTTACCTTTTGAAGTCTCAATGCACTAT
 
. : . : . : . : . : . :
rJMSF004M20+ CCTCAGGACTAAACCCAAGATTCTATTAATAAATCGAACAGAGTTTTTNGAATAAATTCC
rJMSF009M15+ CCTCAGGACTAAACCCAAGATTCTGTTAATAAATCGAACAGAGTTTTTTGAATAAATTCC
                      ____________________________________________________________
consensus CCTCAGGACTAAACCCAAGATTCTGTTAATAAATCGAACAGAGTTTTTTGAATAAATTCC
 
. : . : . : . : . : . :
rJMSF004M20+ TTTGGGATTTATGTATCAATCCGCAGAAGATT
rJMSF009M15+ TTTGGGATTTATGTATCAATCCGCAGAAGATTGTGTTTGCTATTGGTTGAACACATCAAC
                      ____________________________________________________________
consensus TTTGGGATTTATGTATCAATCCGCAGAAGATTGTGTTTGCTATTGGTTGAACACATCAAC