Previous Contig 011526:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009K21Sequence303011526 (2)gb:AY086458_15715061e-11Arabidopsis thaliana clone 252174 mRNA, complete sequence.617011526 (2)gb:AY086458_15715061e-43Arabidopsis thaliana clone 252174 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF009K21- CGGTCGGCCCGCAAATGA
rJMSF009K21+ GTCGGCCCGCAAATGA
                      ____________________________________________________________
consensus CGGTCGGCCCGCAAATGA
 
. : . : . : . : . : . :
JMSF009K21- ACACTGAACACCCAAATTCATCTTCTTTCTACATTTTTCCTGCGAAAAAACCGAGAAGCA
rJMSF009K21+ ACACTGAACACCCAAATTCATCTTCTTTCTACATTTTTCCTGCGAAAAAACCGAGAAGCA
                      ____________________________________________________________
consensus ACACTGAACACCCAAATTCATCTTCTTTCTACATTTTTCCTGCGAAAAAACCGAGAAGCA
 
. : . : . : . : . : . :
JMSF009K21- GCTTCAATCCTCTGCAAACACAAGTTAATCAGAAGCCTTAGTCGCCTTATTCTGTGTTCC
rJMSF009K21+ GCTTCAATCCTCTGCAAACACAAGTTAATCAGAAGCCTTAGTCGCCTTATTCTGTGTTCC
                      ____________________________________________________________
consensus GCTTCAATCCTCTGCAAACACAAGTTAATCAGAAGCCTTAGTCGCCTTATTCTGTGTTCC
 
. : . : . : . : . : . :
JMSF009K21- TCCTATATGAGCTGAGTTCATCATGGTGGATGTGCGTAGTTGTGGGAAGCTTGTTGCCTT
rJMSF009K21+ TCCTATATGAGCTGAGTTCATCATGGTGGATGTGCGTAGTTGTGGGAAGCTTGTTGCCTT
                      ____________________________________________________________
consensus TCCTATATGAGCTGAGTTCATCATGGTGGATGTGCGTAGTTGTGGGAAGCTTGTTGCCTT
 
. : . : . : . : . : . :
JMSF009K21- GGCAACTTTAGTCTCAGTTGGGATCGCGTTGCAAATACTGGCTTGTGCTTTGTTCAATAA
rJMSF009K21+ GGCAACTTTAGTCTCAGTTGGGATCGCGTTGCAAATACTGGCTTGTGCTTTGTTCAATAA
                      ____________________________________________________________
consensus GGCAACTTTAGTCTCAGTTGGGATCGCGTTGCAAATACTGGCTTGTGCTTTGTTCAATAA
 
. : . : . : . : . : . :
JMSF009K21- CTGGTGGCCAATGCTAACAGCAATAATGTATGTCATGCTTCCGAT
rJMSF009K21+ CTGGTGGCCAATGCTAACAGCAATAATGTATGTCATGCTTCCGATGCCTTTGGTTTTCTT
                      ____________________________________________________________
consensus CTGGTGGCCAATGCTAACAGCAATAATGTATGTCATGCTTCCGATGCCTTTGGTTTTCTT
 
. : . : . : . : . : . :
rJMSF009K21+ TGCGGGATCAGATGCTTCGTCTCTCTACTCTGCATCTGAAAACGGCTGGGTGGAAGCAAC
                      ____________________________________________________________
consensus TGCGGGATCAGATGCTTCGTCTCTCTACTCTGCATCTGAAAACGGCTGGGTGGAAGCAAC
 
. : . : . : . : . : . :
rJMSF009K21+ TAAGTTCTTGACCGGAGCTTCAGCGGTTGGCAGCATCGCAATCCCAGTCATCTTAAAGCA
                      ____________________________________________________________
consensus TAAGTTCTTGACCGGAGCTTCAGCGGTTGGCAGCATCGCAATCCCAGTCATCTTAAAGCA
 
. : . : . : . : . : . :
rJMSF009K21+ CGGTGGTGTGATCGGTTGGGGAGCCATGGCGATGGAACTCTCATCGTTCTTCGTTTTTGT
                      ____________________________________________________________
consensus CGGTGGTGTGATCGGTTGGGGAGCCATGGCGATGGAACTCTCATCGTTCTTCGTTTTTGT
 
. : . : . : . : . : . :
rJMSF009K21+ TCTAGCTATTGTTTGTTACATTGTAACCGGTGACGATGGTAGCTACAATATACTTTGATC
                      ____________________________________________________________
consensus TCTAGCTATTGTTTGTTACATTGTAACCGGTGACGATGGTAGCTACAATATACTTTGATC
 
. : . : . : . : . : . :
rJMSF009K21+ CCCCATTAATCTCCTGTTTTCCATGTATAAGATGTTCATGTGCCTCCATTCTTGTTGTTA
                      ____________________________________________________________
consensus CCCCATTAATCTCCTGTTTTCCATGTATAAGATGTTCATGTGCCTCCATTCTTGTTGTTA