Previous Contig 011517:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036L08Sequence577001604 (5)gb:AB017061_15133163e-21Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E20.>gb:AY136382_15752011517 (2)gb:AE016959_10205962e-33Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06
JMSF009I13Sequence438001604 (5)gb:AB017061_15133164e-19Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E20.>gb:AY136382_15785011517 (2)gb:AE016959_10205962e-33Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009I13+ ATTAC
                      ____________________________________________________________
consensus ATTAC
 
. : . : . : . : . : . :
rJMFF036L08+ ACATAATGCAGCAGAAACGTACTCCAAGTTGATTGAGGAGATGAGGGGATCGACCATAAT
rJMSF009I13+ ACATAATGCAGCAGAAACGTACTCCAAGTTGATTGAGGAGATGAGGGGATCGACCATAAT
                      ____________________________________________________________
consensus ACATAATGCAGCAGAAACGTACTCCAAGTTGATTGAGGAGATGAGGGGATCGACCATAAT
 
. : . : . : . : . : . :
rJMFF036L08+ GCAGAAGATAAATGCCCTGATATGTATGTTGAGTGACCAGATAAATCATCGTAGGGAAGA
rJMSF009I13+ GCAGAAGATAAATGCCCTGATATGTATGTTGAGTGACCAGATAAATCATCGTAGGGAAGA
                      ____________________________________________________________
consensus GCAGAAGATAAATGCCCTGATATGTATGTTGAGTGACCAGATAAATCATCGTAGGGAAGA
 
. : . : . : . : . : . :
rJMFF036L08+ GTCTAGCAATTGCTTTACCAAACTTGCTCCATCAAAAGAGAAACAGCTACGAGAAAAAGC
rJMSF009I13+ GTCTAGCAATTGCTTTACCAAACTTGCTCCATCAAAAGAGAAACAGCTACGAGAAAAAGC
                      ____________________________________________________________
consensus GTCTAGCAATTGCTTTACCAAACTTGCTCCATCAAAAGAGAAACAGCTACGAGAAAAAGC
 
. : . : . : . : . : . :
rJMFF036L08+ TATTAAAGCACAAAGCTTGAAAGTTTTGTTCTCGTCTGAAGTCATTTTTGAAGTTCATGA
rJMSF009I13+ TATTAAAGCACAAAGCTTGAAAGTTTTGTTCTCGTCTGAAGTCATTTTTGAAGTTCATGA
                      ____________________________________________________________
consensus TATTAAAGCACAAAGCTTGAAAGTTTTGTTCTCGTCTGAAGTCATTTTTGAAGTTCATGA
 
. : . : . : . : . : . :
rJMFF036L08+ TGACTTGACACATGTTGTGAACATTGAAAATCAGGATTGTACATGCCTGGAGTGGAAATT
rJMSF009I13+ TGACTTGACACATGTTGTGAACATTGAAAATCAGGATTGTACATGCCTGGAGTGGAAATT
                      ____________________________________________________________
consensus TGACTTGACACATGTTGTGAACATTGAAAATCAGGATTGTACATGCCTGGAGTGGAAATT
 
. : . : . : . : . : . :
rJMFF036L08+ GAGTGGGCTGCCTTGTTGCCATGCTGTTGCTGTTTTCCTCTCATCTTCCAAGAGTGTGTA
rJMSF009I13+ GAGTGGGCTGCCTTGTTGCCATGCTGTTGCTGTTTTCCTCTCATCTTCCAAGAGTGTGTA
                      ____________________________________________________________
consensus GAGTGGGCTGCCTTGTTGCCATGCTGTTGCTGTTTTCCTCTCATCTTCCAAGAGTGTGTA
 
. : . : . : . : . : . :
rJMFF036L08+ TGACTACTGTCCACAATGGTTCACTGTTGAAAGTTTTCGTTCTGCATATTCTGAGCCCAT
rJMSF009I13+ TGACTACTGTCCACAATGGTTCACTGTTGAAAGTTTTCGTTCTGCATATTCTGAGCCCAT
                      ____________________________________________________________
consensus TGACTACTGTCCACAATGGTTCACTGTTGAAAGTTTTCGTTCTGCATATTCTGAGCCCAT
 
. : . : . : . : . : . :
rJMFF036L08+ TAATCCTATTCCTGGTATTGGGAAGCCTGTCGAGGACGAAGTGGATTCTGAAAGTGCAGA
rJMSF009I13+ TAATCCTATTCCTGGTATTGGGAAGCCTGTCGAGGACGAAGTGGATTCTGAAAGTGCAGA
                      ____________________________________________________________
consensus TAATCCTATTCCTGGTATTGGGAAGCCTGTCGAGGACGAAGTGGATTCTGAAAGTGCAGA
 
. : . : . : . : . : . :
rJMFF036L08+ TGTGCTCCCTCCTTCTCCTTCTCCTTCTCGGTTTCCAGTTCAAGAAAAGGAAGAAGAGAC
rJMSF009I13+ TGTGCTCCCTCCTTCTCCTTCTCCTTCTCGGTTTCCAGTTCAAGAAAAGGAAGAAGAGAC
                      ____________________________________________________________
consensus TGTGCTCCCTCCTTCTCCTTCTCCTTCTCGGTTTCCAGTTCAAGAAAAGGAAGAAGAGAC
 
. : . : . : . : . : . :
rJMFF036L08+ CAAGACAATAGACCCAAATAAGAGGACGGTTATGTGCAGCAAGTGCAAGGAACCAGGACA
rJMSF009I13+ CAAGACAATAGACCCAAATAAGAGGACGGTTATGTGCAGCAAGTGCAAGGAACCAGGACA
                      ____________________________________________________________
consensus CAAGACAATAGACCCAAATAAGAGGACGGTTATGTGCAGCAAGTGCAAGGAACCAGGACA
 
. : . : . : . : . : . :
rJMFF036L08+ TAATAAGGCTTCATGCAAGGTGAGTTTATAGTTCATAGCCATACTAGTAGTTCGTGCATC
rJMSF009I13+ TAATAAGGCTTCATGCAAGGTGAGTTTATAGTTCATAGCCATACTAGTAGTTCGTGCATC
                      ____________________________________________________________
consensus TAATAAGGCTTCATGCAAGGTGAGTTTATAGTTCATAGCCATACTAGTAGTTCGTGCATC
 
. : . : . : . : . : . :
rJMFF036L08+ ATGTACAGCTTTCATAGTTTATAGTGTTAGCTTGCTTGTGCTGTTATTGATAGTTATGAT
rJMSF009I13+ ATGTACAGCTTTCATAGTTTATAGTGTTAGCTTGCTTGTGCTGTTATTGATAGTTATGAT
                      ____________________________________________________________
consensus ATGTACAGCTTTCATAGTTTATAGTGTTAGCTTGCTTGTGCTGTTATTGATAGTTATGAT
 
. : . : . : . : . : . :
rJMFF036L08+ GAGGAAATAACTTAGATTGCCTTTGCAAAA
rJMSF009I13+ GAGGAAATAACTTAGATTGCCTTTGCAAAAAGCAGTAATTCTCCCTGTGTAATGTAATCG
                      ____________________________________________________________
consensus GAGGAAATAACTTAGATTGCCTTTGCAAAAAGCAGTAATTCTCCCTGTGTAATGTAATCG