Previous Contig 011514:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021F07Sequence160014490365011514 (2)gb:AP003804_18336115e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10
JMSF009I04Sequence258008063 (4)786011514 (2)gb:AP003804_18336117e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009I04+ GGGTGN
                      ____________________________________________________________
consensus GGGTGN
 
. : . : . : . : . : . :
rJMSF009I04+ AGNTGCTAGCGAGCTGCGACGCTTGACTCGACTCCCCGTGAAATGTTTGGGATAGGCGGA
                      ____________________________________________________________
consensus AGNTGCTAGCGAGCTGCGACGCTTGACTCGACTCCCCGTGAAATGTTTGGGATAGGCGGA
 
. : . : . : . : . : . :
rJMSF009I04+ GGCACGTCGGTCGGCGGAGGAGGGCGGTCGTGGCCGTCGACGACGTCGGTCGGCGTCAGG
                      ____________________________________________________________
consensus GGCACGTCGGTCGGCGGAGGAGGGCGGTCGTGGCCGTCGACGACGTCGGTCGGCGTCAGG
 
. : . : . : . : . : . :
rJMSF009I04+ GAAAAGGATACAGAAGGAGATGACGGAGCTGAGCTCCGACCCTCAGCCCCACTGCGCCGC
                      ____________________________________________________________
consensus GAAAAGGATACAGAAGGAGATGACGGAGCTGAGCTCCGACCCTCAGCCCCACTGCGCCGC
 
. : . : . : . : . : . :
rJMSF009I04+ CGCCCTAAAGGCGACAATCTCTACCACTGGGTCGCCACTCTCTTCGGTCCTCCTGGAACA
                      ____________________________________________________________
consensus CGCCCTAAAGGCGACAATCTCTACCACTGGGTCGCCACTCTCTTCGGTCCTCCTGGAACA
 
. : . : . : . : . : . :
rJMSF009I04+ CCTTATGACGGTGGAATATATTTCCTTGACATAACATTTCCAATTGATTATCCATTCAAA
                      ____________________________________________________________
consensus CCTTATGACGGTGGAATATATTTCCTTGACATAACATTTCCAATTGATTATCCATTCAAA
 
. : . : . : . : . : . :
rJMSF009I04+ CCTCCAAAGGTTGTTTTCAAAACTCGCATCTATCATTGCAATGTTGATCCTGCCGGCACT
                      ____________________________________________________________
consensus CCTCCAAAGGTTGTTTTCAAAACTCGCATCTATCATTGCAATGTTGATCCTGCCGGCACT
 
. : . : . : . : . : . :
rJMFF021F07+ GGATATTNTGAAGGATAGTTGGAGTCCAGCTTTAACAATCTCGAAGGTGCTA
rJMSF009I04+ GTTAACTTGGATATTTTGAAGGATAGTTGGAGTCCAGCTTTAACAATCTCGAAGGTGCTA
                      ____________________________________________________________
consensus GTTAACTTGGATATTTTGAAGGATAGTTGGAGTCCAGCTTTAACAATCTCGAAGGTGCTA
 
. : . : . : . : . : . :
rJMFF021F07+ CTTGCTCTTAGATCAATGTTTACAACTCCCGACNCCTATAACCCAGTTGTTCCTGGTATC
rJMSF009I04+ CTTGCTCTTAGATCAATGTTTACAACTCCCGACACCTATAACCCAGTTGTTCCTGGTATC
                      ____________________________________________________________
consensus CTTGCTCTTAGATCAATGTTTACAACTCCCGACACCTATAACCCAGTTGTTCCTGGTATC
 
. : . : . : . : . : . :
rJMFF021F07+ GCTCACTTGTATTTGGCGGATAGAGCACGACATGATGAAATAGCTGCAGAGTGGACTCAA
rJMSF009I04+ GCTCACTTGTATTTGGCGGATAGAGCACGACATGATGAAATAGCTGCAGAGTGGACTCAA
                      ____________________________________________________________
consensus GCTCACTTGTATTTGGCGGATAGAGCACGACATGATGAAATAGCTGCAGAGTGGACTCAA
 
. : . : . : . : . : . :
rJMFF021F07+ AGATTTGCAAGGTAAATGGTTCACTTTGCAATAATTGAACCACTTTTTGCTTCCTCTAGC
rJMSF009I04+ AGATTTGCAAGGTAAATGGTTCACTTTGCAATAATTGAACCACTTTTTGCTTCCTCTAGC
                      ____________________________________________________________
consensus AGATTTGCAAGGTAAATGGTTCACTTTGCAATAATTGAACCACTTTTTGCTTCCTCTAGC
 
. : . : . : . : . : . :
rJMFF021F07+ TCTACTCGAAGGCATCAAAACGCGCCCATCGTGGGAAACTTGTAAAGGTGTAATTGTTAT
rJMSF009I04+ TCTACTCGAAGGCATCAAAACGCGCCCATCGTGGGAAACTTGTAAAGGTGTAATTGTTAT
                      ____________________________________________________________
consensus TCTACTCGAAGGCATCAAAACGCGCCCATCGTGGGAAACTTGTAAAGGTGTAATTGTTAT
 
. : . : . : . : . : . :
rJMFF021F07+ CTCGCTATTAGATTTGTTGCCAGGGACGACTGAATTCCGCTGTAATTACTAACTAGTCTT
rJMSF009I04+ CTCGCTATTAGATTTGTTGCCAGGGACGACTGAATTCCGCTGTAATTACTAACTAGTCTT
                      ____________________________________________________________
consensus CTCGCTATTAGATTTGTTGCCAGGGACGACTGAATTCCGCTGTAATTACTAACTAGTCTT
 
. : . : . : . : . : . :
rJMFF021F07+ GGATAGCTTACA
rJMSF009I04+ GGATAGCTTACATGTTTGATAAACAAGATCTCATGTTGTCTCAGATGCAATTTCTTGAGC
                      ____________________________________________________________
consensus GGATAGCTTACATGTTTGATAAACAAGATCTCATGTTGTCTCAGATGCAATTTCTTGAGC