Previous Contig 011512:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN028C24Sequence441011512 (2)pir|G96585|G965859e-29hypothetical protein F20D21.22 [imported] - Arabidopsis thaliana>gb:AE005173_893
JMSF009I01Sequence355018626gb:AY099578_15766046e-33Arabidopsis thaliana unknown protein (At1g54390) mRNA, complete cds.>gb:BT002159765011512 (2)gb:AY085569_15706384e-44Arabidopsis thaliana clone 157730 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN028C24- ACAATGCACTAAGACCTCTGCACAGAGAAAGTTTTGCTTGCAAGACTAGCTC
                      ____________________________________________________________
consensus ACAATGCACTAAGACCTCTGCACAGAGAAAGTTTTGCTTGCAAGACTAGCTC
 
. : . : . : . : . : . :
JMFN028C24- ATGACCTTATATATAGCCACATAAAACGCCTAGATGAAGATCTTAACAACTTCGTAGAAG
                      ____________________________________________________________
consensus ATGACCTTATATATAGCCACATAAAACGCCTAGATGAAGATCTTAACAACTTCGTAGAAG
 
. : . : . : . : . : . :
JMFN028C24- ATCTGAAGCAAGAGGGAAACTTACCAGCTGATGAACCTGCCGCCCTTCCTCCATTACCTT
rJMSF009I01+ GGGAAAATTACCAGCTGATGAACCTGCGGTCCTTCCTCCATTACCTT
                      ____________________________________________________________
consensus ATCTGAAGCAAGAGGGAAACTTACCAGCTGATGAACCTGCGGTCCTTCCTCCATTACCTT
 
. : . : . : . : . : . :
JMFN028C24- AGGTCCTCAAAACTGAAAAGCGCAAACCTATATATGGAACACCTTAATCAAAGAGGCTTG
rJMSF009I01+ TGGTCCTCAAAACTGAAAAGCGCAAACCTATATATGGAACACCTCAATCAAAGAGGCTTG
                      ____________________________________________________________
consensus TGGTCCTCAAAACTGAAAAGCGCAAACCTATATATGGAACACCTTAATCAAAGAGGCTTG
 
. : . : . : . : . : . :
JMFN028C24- AATATTGGGACCGGGATTGGGACCGCGAGCGTGACAGATACTTTGAGCTTATGCTCCCTC
rJMSF009I01+ AATATAGGGACAGGGATTGGGACCGCGAGCGTGACAGAGACTTTGAGCTTATGCCACCTC
                      ____________________________________________________________
consensus AATATTGGGACCGGGATTGGGACCGCGAGCGTGACAGATACTTTGAGCTTATGCTCCCTC
 
. : . : . : . : . : . :
JMFN028C24- CAGGAGGCCTCAAAAAGGATTCCTCTTCCCCAGCTGATATTTGATCAACCCATTGATCCA
rJMSF009I01+ CAGGAGGCCTCAAAAAGGATTTCTCTTCTCCAGTTGATA-TTGATCAACCCATTGATCCA
                      ____________________________________________________________
consensus CAGGAGGCCTCAAAAAGGATTTCTCTTCTCCAGTTGATATTTGATCAACCCATTGATCCA
 
. : . : . : . : . : . :
JMFN028C24- AATGAACCCACTTACTGTGTCTGTCATCAGGCTATCCTTTGGCGAAACTATTGCTTGGGA
rJMSF009I01+ AATGAACCCACTTACTGTGTCTGTCATCAGG-TATCCTTTGGCGATATGATTGCTTGTGA
                      ____________________________________________________________
consensus AATGAACCCACTTACTGTGTCTGTCATCAGGCTATCCTTTGGCGATATTATTGCTTGTGA
 
. : . : . : . : . : . :
JMFN028C24- CAATGAACATTGCCACGGAGGCGAATGGT
rJMSF009I01+ CAATGAAAATTGCCAAGGAGGTGAATGGTTCCATTATGCATGTGTTGGGCTCACGCCTGA
                      ____________________________________________________________
consensus CAATGAACATTGCCACGGAGGTGAATGGTTCCATTATGCATGTGTTGGGCTCACGCCTGA
 
. : . : . : . : . : . :
rJMSF009I01+ GACTAGATTTAAAGGCAAGTGGTACTGTCCAACCTGCAGACAGTTACCACACTGATCAGA
                      ____________________________________________________________
consensus GACTAGATTTAAAGGCAAGTGGTACTGTCCAACCTGCAGACAGTTACCACACTGATCAGA
 
. : . : . : . : . : . :
rJMSF009I01+ CATGCTGTTCTTGTGCATGGTGCTCTAATGTTTTTGGACTGGAGCACAGTTGGGAAAGGA
                      ____________________________________________________________
consensus CATGCTGTTCTTGTGCATGGTGCTCTAATGTTTTTGGACTGGAGCACAGTTGGGAAAGGA
 
. : . : . : . : . : . :
rJMSF009I01+ TTATTTTAATTATGGAACTCTTGTGTATTTATGCCTGAGCTGCTCTCAAACAATAGCTGC
                      ____________________________________________________________
consensus TTATTTTAATTATGGAACTCTTGTGTATTTATGCCTGAGCTGCTCTCAAACAATAGCTGC
 
. : . : . : . : . : . :
rJMSF009I01+ ATATTGTATAATGGCAGGTGAAGAAATGGAAAACAAATTTTGGAAGGGAGCAATTTGTGC
                      ____________________________________________________________
consensus ATATTGTATAATGGCAGGTGAAGAAATGGAAAACAAATTTTGGAAGGGAGCAATTTGTGC
 
. : . : . : . : . : . :
rJMSF009I01+ TATAAACACTTTAGCTGGGGACTGCAAGATAGAGTTTGGGAAAGGAGCTTAATTAGTTTT
                      ____________________________________________________________
consensus TATAAACACTTTAGCTGGGGACTGCAAGATAGAGTTTGGGAAAGGAGCTTAATTAGTTTT
 
. : . : . : . : . : . :
rJMSF009I01+ CACGTCGTCTCATAGTTTATATAAATCCCCAAGAGATGCAGTCAGTCTTTAGATTTAACA
                      ____________________________________________________________
consensus CACGTCGTCTCATAGTTTATATAAATCCCCAAGAGATGCAGTCAGTCTTTAGATTTAACA
 
. : . : . : . : . : . :
rJMSF009I01+ ATTGTAAAGTAGACTGCTTTCTTTCTGTATATTGACAGCCTGCTTGAGTAAACAAATCTT
                      ____________________________________________________________
consensus ATTGTAAAGTAGACTGCTTTCTTTCTGTATATTGACAGCCTGCTTGAGTAAACAAATCTT