Previous Contig 011508:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009H10Sequence462011508 (6)746011508 (6)gb:AP002972_18240759e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P063
JMSF046B14Sequence480011508 (6)gb:AP002972_18240754e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P063652011508 (6)gb:AP002972_18240751e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P063
JMSF051B01Sequence677011508 (6)gb:AP002972_18240752e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P063755011508 (6)gb:AP002972_18240756e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P063

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF009H10- GATTTTCCTTCATCCTCTGTAGTCTGAACTCGATCGTCCATTAT
JMSF046B14- GTCCATTAT
JMSF051B01- GTCCATTAT
                      ____________________________________________________________
consensus GATTTTCCTTCATCCTCTGTAGTCTGAACTCGATCGTCCATTAT
 
. : . : . : . : . : . :
JMSF009H10- ATTCTCTCTCCTTTCAATTACATAACACTCCCAAGGCGCAACCTCACTCAGAGACTCCCC
JMSF046B14- ATTCTCTCTCCTTTCAATTACATAACACTCCCAAGGCGCAACCTCACTCAGAGACTCCCC
JMSF051B01- ATTCTCTCTCCTTTCAATTACATAACACTCCCAAGGCGCAACCTCACTCAGAGACTCCCC
                      ____________________________________________________________
consensus ATTCTCTCTCCTTTCAATTACATAACACTCCCAAGGCGCAACCTCACTCAGAGACTCCCC
 
. : . : . : . : . : . :
JMSF009H10- ATTTCTTCCTATAATAACACAAATACCCTTCAATCCTCCAATCCCAATGATTCGCCCTGC
JMSF046B14- ATTTCTTCCTATAATAACACAAATACCCTTCAATCCTCCAATCCCAATGATTCGCCCTGC
JMSF051B01- ATTTCTTCCTATAATAACACAAATACCCTTCAATCCTCCAATCCCAATGATTCGCCCTGC
                      ____________________________________________________________
consensus ATTTCTTCCTATAATAACACAAATACCCTTCAATCCTCCAATCCCAATGATTCGCCCTGC
 
. : . : . : . : . : . :
JMSF009H10- TTTTCCTCTCTCGAACTCTGTAATTTTCACCGAATCCTGCACTTCCATTCACCTATTTTC
JMSF046B14- TTTTCCTCTCTCGAACTCTGTAATTTTCACCGAATCCTGCACTTCCATTCACCTATTTTC
JMSF051B01- TTTTCCTCTCTCGAACTCTGTAATTTTCACCGAATCCTGCACTTCCATTCACCTATTTTC
                      ____________________________________________________________
consensus TTTTCCTCTCTCGAACTCTGTAATTTTCACCGAATCCTGCACTTCCATTCACCTATTTTC
 
. : . : . : . : . : . :
JMSF009H10- ACCGAAATAAGTTCCCAACATGCTATCAATCATTCCGAATTTCTCGGATTCCGTGGAAAA
JMSF046B14- ACCGAAATAAGTTCCCAACATGCTATCAATCATTCCGAATTTCTCGGATTCCGTGGAAAA
JMSF051B01- ACCGAAATAAGTTCCCAACATGCTATCAATCATTCCGAATTTCTCGGATTCCGTGGAAAA
                      ____________________________________________________________
consensus ACCGAAATAAGTTCCCAACATGCTATCAATCATTCCGAATTTCTCGGATTCCGTGGAAAA
 
. : . : . : . : . : . :
JMSF009H10- TTGATCGATTAAAGTTTTGAGATTTGGATATAATCAGTTCAATTGAATTCAGGGTTTTTA
JMSF046B14- TTGATCGATTAAAGTTTTGAGATTTGGATATAATCAGTTCAATTGAATTCAGGGTTTTTA
JMSF051B01- TTGATCGATTAAAGTTTTGAGATTTGGATATAATCAGTTCAATTGAATTCAGGGTTTTTA
                      ____________________________________________________________
consensus TTGATCGATTAAAGTTTTGAGATTTGGATATAATCAGTTCAATTGAATTCAGGGTTTTTA
 
. : . : . : . : . : . :
JMSF009H10- GTATTTTTGGGTGAAATGAAGATCGAAGAGTTGGATGAGACCGGTGAGAGCATGTGTAGA
JMSF046B14- GTATTTTTGGGTGAAATGAAGATCGAAGAGTTGGATGAGACCGGTGAGAGCATGTGTAGA
JMSF051B01- GTATTTTTGGGTGAAATGAAGATCGAAGAGTTGGATGAGACCGGTGAGAGCATGTGTAGA
                      ____________________________________________________________
consensus GTATTTTTGGGTGAAATGAAGATCGAAGAGTTGGATGAGACCGGTGAGAGCATGTGTAGA
 
. : . : . : . : . : . :
JMSF009H10- AGTGAAAGCGAAACCAGGTTGATGATAGTTCGAGTCGACGCGAAGCGAGCGCTAGTCG
JMSF046B14- AGTGAAAGCGAAACCAGGTTGATGATAGTTCGAGTCGACGCGAAGCGAGCGCTAGTCGGA
JMSF051B01- AGTGAAAGCGAAACCAGGTTGATGATAGTTCGAGTCGACGCGAAGCGAGCGCTAGTCGGA
                      ____________________________________________________________
consensus AGTGAAAGCGAAACCAGGTTGATGATAGTTCGAGTCGACGCGAAGCGAGCGCTAGTCGGA
 
. : . : . : . : . : . :
JMSF046B14- GCCGGTGCTCGGATCCTCTTCTACCCGACCCTTCTCTACAATGTTTTCCG
JMSF051B01- GCCGGTGCTCGGATCCTCTTCTACCCGACCCTTCTCTACAATGTTTTCCGCAACAAAATT
                      ____________________________________________________________
consensus GCCGGTGCTCGGATCCTCTTCTACCCGACCCTTCTCTACAATGTTTTCCGCAACAAAATT
 
. : . : . : . : . : . :
JMSF051B01- CAGGCTGAGTTTCGATGGTGGGATCAGATTGATCAGTTTCTCTTGCTTGGAGCTGTACCG
rJMSF051B01+ GGATCAGATTGATCAGTTTCTCTTGCTNGGAGCTGTACCG
                      ____________________________________________________________
consensus CAGGCTGAGTTTCGATGGTGGGATCAGATTGATCAGTTTCTCTTGCTTGGAGCTGTACCG
 
. : . : . : . : . : . :
JMSF051B01- TTTTCAAAGGATGTACCTCGATTGAAGAAGCTTGGAGTTGGTGGTGTAATCACTTTGAAT
rJMSF051B01+ TTTTCAAAGGATGTACCTCGATTGAAGAAGCTTGGAGTTGGTGGTGTAATCACNTTGAAT
rJMSF009H10+ GGAGTTGGTGGTGTAATCACTTTGAAT
                      ____________________________________________________________
consensus TTTTCAAAGGATGTACCTCGATTGAAGAAGCTTGGAGTTGGTGGTGTAATCACTTTGAAT
 
. : . : . : . : . : . :
JMSF051B01- GAGCCATATGAAACATTGGTTCCGACCTCACTATACCGTGCACTTGGGATAGACCATCTT
rJMSF051B01+ GAGCCATATGAAACATTGGTTCCGACCTCACTATACCGTGCACTTGGGATAGACCATCTT
rJMSF046B14+ TTCCGACCTCACTATACCGTGCACTTGGGATAGACCATCTT
rJMSF009H10+ GAGCCATATGAAACATTGGTTCCGACCTCACTATACCGTGCACTTGGGATAGACCATCTT
                      ____________________________________________________________
consensus GAGCCATATGAAACATTGGTTCCGACCTCACTATACCGTGCACTTGGGATAGACCATCTT
 
. : . : . : . : . : . :
JMSF051B01- GTCATTC
rJMSF051B01+ GTCATTCCAACCAGAGATTATTTGTTTGCCCCTTCATTTGGGGATATTAACCGAGCAGTG
rJMSF046B14+ GTCATTCCAACCAGAGATTATTTGTTTGCCCCTTCATTTGGGGATATTAACCGAGCAGTG
rJMSF009H10+ GTCATTCCAACCAGAGATTATTTGTTTGCCCCTTCATTTGGGGATATTAACCGAGCAGTG
                      ____________________________________________________________
consensus GTCATTCCAACCAGAGATTATTTGTTTGCCCCTTCATTTGGGGATATTAACCGAGCAGTG
 
. : . : . : . : . : . :
rJMSF051B01+ GATTTTA-TTCACAAAAATGCATTGAGTGGTCGGACTACATATGTCCATTGCAAAGCTGG
rJMSF046B14+ GATTTTATTTCACAAAAATGCATTGAGTGGTCGGACTACATATGTCCATTGCAAAGCTGG
rJMSF009H10+ GATTTTA-TTCACAAAAATGCATTGAGTGGTCGGACTACATATGTCCATTGCAAAGCTGG
                      ____________________________________________________________
consensus GATTTTA-TTCACAAAAATGCATTGAGTGGTCGGACTACATATGTCCATTGCAAAGCTGG
 
. : . : . : . : . : . :
rJMSF051B01+ GAGGGGAAGGAGTACAACCATTGTGCTTTGCTATTTGGTGGAGTATAAAAACATGACTCC
rJMSF046B14+ GAGGGGAAGGAGTACAACCATTGTGCTTTGCTATTTGGTGGAGTATAAAAACATGACTCC
rJMSF009H10+ GAGGGGAAGGAGTACAACCATTGTGCTTTGCTATTTGGTGGAGTATAAAAACATGACTCC
                      ____________________________________________________________
consensus GAGGGGAAGGAGTACAACCATTGTGCTTTGCTATTTGGTGGAGTATAAAAACATGACTCC
 
. : . : . : . : . : . :
rJMSF051B01+ TTCAGAGGCACTGGAGTATGTTCGCTCAATAAGACCTAGAGTCCTATTGGCTCCTTCTCA
rJMSF046B14+ TTCAGAGGCACTGGAGTATGTTCGCTCAATAAGACCTAGAGTCCTATTGGCTCCTTCTCA
rJMSF009H10+ TTCAGAGGCACTGGAGTATGTTCGCTCAATAAGACCTAGAGTCCTATTGGCTCCTTCTCA
                      ____________________________________________________________
consensus TTCAGAGGCACTGGAGTATGTTCGCTCAATAAGACCTAGAGTCCTATTGGCTCCTTCTCA
 
. : . : . : . : . : . :
rJMSF051B01+ ATGGAAGGCGGTTCAGGAATTCAGGCAGTGGCGAGCGGCATCAACTTCTTCATTCTCTCC
rJMSF046B14+ ATGGAAGGCGGTTCAGGAATTCAGGCAGTGGCGAGCGGCATCAACTTCTTCATTCTCTCC
rJMSF009H10+ ATGGAAGGCGGTTCAGGAATTCAGGCAGTGGCGAGCGGCATCAACTTCTTCATTCTCTCC
                      ____________________________________________________________
consensus ATGGAAGGCGGTTCAGGAATTCAGGCAGTGGCGAGCGGCATCAACTTCTTCATTCTCTCC
 
. : . : . : . : . : . :
rJMSF051B01+ ATCCGGAGATGCTGTACTGATCACAAAAGCAGATCTAGAAGGGTACAATAGCTCTTCCGA
rJMSF046B14+ ATCCGGAGATGCTGTACTGATCACAAAAGCAGATCTAGAAGGGTACAATAGCTCTTCCGA
rJMSF009H10+ ATCCGGAGATGCTGTACTGATCACAAAAGCAGATCTAGAAGGGTACAATAGCTCTTCCGA
                      ____________________________________________________________
consensus ATCCGGAGATGCTGTACTGATCACAAAAGCAGATCTAGAAGGGTACAATAGCTCTTCCGA
 
. : . : . : . : . : . :
rJMSF051B01+ TGACAACATTGGTAAGGAGTTGGCAGTTGTACCCCGAATGACACGGACGACAAGCCCAAT
rJMSF046B14+ TGACAACATTGGTAAGGAGTTGGCAGTTGTACCCCGAATGACACGGACGACAAGCCCAAT
rJMSF009H10+ TGACAACATTGGTAAGGAGTTGGCAGTTGTACCCCGAATGACACGGACGACAAGCCCAAT
                      ____________________________________________________________
consensus TGACAACATTGGTAAGGAGTTGGCAGTTGTACCCCGAATGACACGGACGACAAGCCCAAT
 
. : . : . : . : . : . :
rJMSF051B01+ GATAGCAAGGCTATCCTGCCTGTTCTCGACGTTGAAAGCTTCAAGCAGTTGCGGGCCAAT
rJMSF046B14+ GATAGCAAGGCTATCCTGCCTGTTCTCGACGTTGAAAGCTTCAAGCAGTTGCGGGCCAAT
rJMSF009H10+ GATAGCAAGGCTATCCTGCCTGTTCTCGACGTTGAAAGCTTCAAGCAGTTGCGGGCCAAT
                      ____________________________________________________________
consensus GATAGCAAGGCTATCCTGCCTGTTCTCGACGTTGAAAGCTTCAAGCAGTTGCGGGCCAAT
 
. : . : . : . : . : . :
rJMSF051B01+ CACAAGGCAGCTGACTGACGCCCGCGCTTGCTAGTACAAAACTGCTCGCTCTCTTGTACA
rJMSF046B14+ CACAAGGCAGCTGACTGACGCCCGCGCTTGCTAGTACAAAACTGCTCGCTCTCTTGTACA
rJMSF009H10+ CACAAGGCAGCTGACTGACGCCCGCGCTTGCTAGTACAAAACTGCTCGCTCTCTTGTACA
                      ____________________________________________________________
consensus CACAAGGCAGCTGACTGACGCCCGCGCTTGCTAGTACAAAACTGCTCGCTCTCTTGTACA
 
. : . : . : . : . : . :
rJMSF051B01+ GAAGAGGAATACTCGAAATAAGCTTAGCAGAGTG
rJMSF046B14+ GAAGAGGAATACTCGAAATAAGCTTAGCAGAGTG
rJMSF009H10+ GAAGAGGAATACTCGAAATAAGCTTAGCAGAGTGGTATGTGTACCTCTAATCCCTTGTTT
                      ____________________________________________________________
consensus GAAGAGGAATACTCGAAATAAGCTTAGCAGAGTGGTATGTGTACCTCTAATCCCTTGTTT
 
. : . : . : . : . : . :
rJMSF009H10+ ATGTGTGAATACCGTGTATCGTAAGTAGGAGGAAAACTGCGTTAAATTATGTCTGTATAA
                      ____________________________________________________________
consensus ATGTGTGAATACCGTGTATCGTAAGTAGGAGGAAAACTGCGTTAAATTATGTCTGTATAA