Previous Contig 011505:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009G24Sequence248001730 (4)751011505 (2)sp|P48627|FD6C_BRANAe-115Omega-6 fatty acid desaturase, chloroplast precursor (EC 1.14.19.-).>pir|T08136|
JMSF019P07Sequence490001730 (4)gb:AY772187_16280899e-20Olea europaea subsp. europaea chloroplast fatty acid desaturase 6 (fad6) mRNA, c738011505 (2)sp|P48627|FD6C_BRANAe-112Omega-6 fatty acid desaturase, chloroplast precursor (EC 1.14.19.-).>pir|T08136|

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019P07+ TGATAATTGCTATGGGAC
rJMSF009G24+ TTGCGTAAGGCATTGATAATTGCTATGGGAC
                      ____________________________________________________________
consensus TTGCGTAAGGCATTGATAATTGCTATGGGAC
 
. : . : . : . : . : . :
rJMSF019P07+ CCATTCGACCTTGGATGTCTATAGCTCACTGGTTGGTCTGCCATTTTAATTTGAACAAGT
rJMSF009G24+ CCATTCGACCTTGGATGTCTATAGCTCACTGGTTGGTCTGCCATTTTAATTTGAACAAGT
                      ____________________________________________________________
consensus CCATTCGACCTTGGATGTCTATAGCTCACTGGTTGGTCTGCCATTTTAATTTGAACAAGT
 
. : . : . : . : . : . :
rJMSF019P07+ TCAGACCTAGCGAAGTCAATAGAGTAAAAATAAGCTTAGCCTGCGTCTTTGCTTTCATGG
rJMSF009G24+ TCAGACCTAGCGAAGTCAATAGAGTAAAAATAAGCTTAGCCTGCGTCTTTGCTTTCATGG
                      ____________________________________________________________
consensus TCAGACCTAGCGAAGTCAATAGAGTAAAAATAAGCTTAGCCTGCGTCTTTGCTTTCATGG
 
. : . : . : . : . : . :
rJMSF019P07+ CTATTGGATGGCCGTTGATCATCTACAAAGCGGGAATAATTGGATGGGTCAAGTTTTGGC
rJMSF009G24+ CTATTGGATGGCCGTTGATCATCTACAAAGCGGGAATAATTGGATGGGTCAAGTTTTGGC
                      ____________________________________________________________
consensus CTATTGGATGGCCGTTGATCATCTACAAAGCGGGAATAATTGGATGGGTCAAGTTTTGGC
 
. : . : . : . : . : . :
rJMSF019P07+ TCATGCCATGGCTGGGTTATCACTTTTGGATGAGTACCTTTACAATGGTCCATCATACCG
rJMSF009G24+ TCATGCCATGGCTGGGTTATCACTTTTGGATGAGTACCTTTACAATGGTCCATCATACCG
                      ____________________________________________________________
consensus TCATGCCATGGCTGGGTTATCACTTTTGGATGAGTACCTTTACAATGGTCCATCATACCG
 
. : . : . : . : . : . :
rJMSF019P07+ CTCCTCACATTCCCTTCAAATATTCAAACGAGTGGAATGCAGCTCAAGCCCAGCTTAATG
rJMSF009G24+ CTCCTCACATTCCCTTCAAATATTCAAACGAGTGGAATGCAGCTCAAGCCCAGCTTAATG
                      ____________________________________________________________
consensus CTCCTCACATTCCCTTCAAATATTCAAACGAGTGGAATGCAGCTCAAGCCCAGCTTAATG
 
. : . : . : . : . : . :
rJMSF019P07+ GCACAGTTCATTGCGACTATCCTCGTTGGATTGAGATCCTTTGCCACGATATTAATGTTC
rJMSF009G24+ GCACAGTTCATTGCGACTATCCTCGTTGGATTGAGATCCTTTGCCACGATATTAATGTTC
                      ____________________________________________________________
consensus GCACAGTTCATTGCGACTATCCTCGTTGGATTGAGATCCTTTGCCACGATATTAATGTTC
 
. : . : . : . : . : . :
rJMSF019P07+ ACATACCCCACCATGTCTCCCCGAGAATACCAAGCTATAATCTGCGGGATGCTCATAAAT
rJMSF009G24+ ACATACCCCACCATGTCTCCCCGAGAATACCAAGCTATAATCTGCGGGATGCTCATAAAT
                      ____________________________________________________________
consensus ACATACCCCACCATGTCTCCCCGAGAATACCAAGCTATAATCTGCGGGATGCTCATAAAT
 
. : . : . : . : . : . :
rJMSF019P07+ CCATCCAAGAGAATTGGGGAAGGTACTTGAATGAGGCCACATGGAATTGGCGTCTAATGA
rJMSF009G24+ CCATCCAAGAGAATTGGGGAAGGTACTTGAATGAGGCCACATGGAATTGGCGTCTAATGA
                      ____________________________________________________________
consensus CCATCCAAGAGAATTGGGGAAGGTACTTGAATGAGGCCACATGGAATTGGCGTCTAATGA
 
. : . : . : . : . : . :
rJMSF019P07+ AGACGATAATGACAATGTGTCATGTCTATGATAAGGAGCGGAACTATATTCCATTTGACG
rJMSF009G24+ AGACGATAATGACAATGTGTCATGTCTATGATAAGGAGCGGAACTATATTCCATTTGACG
                      ____________________________________________________________
consensus AGACGATAATGACAATGTGTCATGTCTATGATAAGGAGCGGAACTATATTCCATTTGACG
 
. : . : . : . : . : . :
rJMSF019P07+ AACTTGCCCCTACCGAATCCCAACCAATCACTTTCCTTAAAAAAGTAATGCCCGAGTACG
rJMSF009G24+ AACTTGCCCCTACCGAATCCCAACCAATCACTTTCCTTAAAAAAGTAATGCCCGAGTACG
                      ____________________________________________________________
consensus AACTTGCCCCTACCGAATCCCAACCAATCACTTTCCTTAAAAAAGTAATGCCCGAGTACG
 
. : . : . : . : . : . :
rJMSF019P07+ CTTAGCAAATTGATTCTGTATTACTAATCGATTGTTCTTTAGAGCTTCCTCCATTTTTGT
rJMSF009G24+ CTTAGCAAATTGATTCTGTATTACTAATCGATTGTTCTTTAGAGCTTCCTCCATTTTTGT
                      ____________________________________________________________
consensus CTTAGCAAATTGATTCTGTATTACTAATCGATTGTTCTTTAGAGCTTCCTCCATTTTTGT
 
. : . : . : . : . : . :
rJMSF019P07+ TTGCAGTTAAGCTAGTTTTCTTAGTTCATTTCTATATAAACAGACTTTGTCCCAGACATT
rJMSF009G24+ TTGCAGTTAAGCTAGTTTTCTTAGTTCATTTCTATATAAACAGACTTTGTCCCAGACATT
                      ____________________________________________________________
consensus TTGCAGTTAAGCTAGTTTTCTTAGTTCATTTCTATATAAACAGACTTTGTCCCAGACATT