Previous Contig 011500:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005M01Sequence413011500 (6)gb:GMU51194_16806887e-39Glycine max peroxidase (sEPb2) mRNA, partial cds.
JMSF005M03Sequence339005474 (26)406011500 (6)gb:GMU51194_16806887e-24Glycine max peroxidase (sEPb2) mRNA, partial cds.
JMSF009F03Sequence389011500 (6)gb:GMU51194_16806889e-34Glycine max peroxidase (sEPb2) mRNA, partial cds.761011500 (6)gb:GMU51193_16806873e-76Glycine max peroxidase (sEPb1) mRNA, partial cds.
JMSF030E14Sequence647011500 (6)gb:GMU51194_16806883e-76Glycine max peroxidase (sEPb2) mRNA, partial cds.761011500 (6)gb:GMU51193_16806871e-77Glycine max peroxidase (sEPb1) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF009F03- AAGCAGTGCATAATAACAATCATAGTT
JMSF005M01- GGCAAGCAGTGCATAATAACAATCATAGTT
JMSF030E14- AAGCAGTGCATAATAACAATCATAGTT
                      ____________________________________________________________
consensus GGCAAGCAGTGCATAATAACAATCATAGTT
 
. : . : . : . : . : . :
JMSF009F03- TCTTAAAGTAACAAGAGTTTCCAGCCATGGCCTCCATTGTTGCCTTGTTGAGCTCATTGA
JMSF005M01- TCTTAAAGTAACAAGAGTTTCCAGCCATGGCCTCCATTGTTGCCTTGTTGAGCTCATTGA
JMSF030E14- TCTTAAAGTAACAAGAGTTTCCAGCCATGGCCTCCATTGTTGCCTTGTTGAGCTCATTGA
                      ____________________________________________________________
consensus TCTTAAAGTAACAAGAGTTTCCAGCCATGGCCTCCATTGTTGCCTTGTTGAGCTCATTGA
 
. : . : . : . : . : . :
JMSF009F03- TGCTTGTCTTCTCCATCATTTCTCTGGGCAATGCACTGAGCTCAAACTACTATGAGAAGA
JMSF005M01- TGCTTGTCTTCTCCATCATTTCTCTGGGCAATGCACTGAGCTCAAACTACTATGAGAAGA
JMSF030E14- TGCTTGTCTTCTCCATCATTTCTCTGGGCAATGCACTGAGCTCAAACTACTATGAGAAGA
                      ____________________________________________________________
consensus TGCTTGTCTTCTCCATCATTTCTCTGGGCAATGCACTGAGCTCAAACTACTATGAGAAGA
 
. : . : . : . : . : . :
JMSF009F03- CATGTCCCCAGGCAGAGAATGCAGTGACACAGGTTGTGAAGAAGGCCTCCATGGCAGACA
JMSF005M01- CATGTCCCCAGGCAGAGAATGCAGTGACACAGGTTGTGAAGAAGGCCTCCATGGCAGACA
JMSF030E14- CATGTCCCCAGGCAGAGAATGCAGTGACACAGGTTGTGAAGAAGGCCTCCATGGCAGACA
                      ____________________________________________________________
consensus CATGTCCCCAGGCAGAGAATGCAGTGACACAGGTTGTGAAGAAGGCCTCCATGGCAGACA
 
. : . : . : . : . : . :
JMSF009F03- AAACTGTTCTTGCTGCTCTGCTGAGGATGCATTTCCATGACTGTTTTATAAGGGGCTGTG
JMSF005M01- AAACTGTTCTTGCTGCTCTGCTGAGGATGCATTTCCATGACTGTTTTATAAGGGGCTGTG
JMSF030E14- AAACTGTTCTTGCTGCTCTGCTGAGGATGCATTTCCATGACTGTTTTATAAGGGGCTGTG
                      ____________________________________________________________
consensus AAACTGTTCTTGCTGCTCTGCTGAGGATGCATTTCCATGACTGTTTTATAAGGGGCTGTG
 
. : . : . : . : . : . :
JMSF009F03- ATGCATCAGTGTTGCTGAACTCAAAGAAGAGTGCTGCAGAGAAGAATGGACCACCTAATC
JMSF005M01- ATGCATCAGTGTTGCTGAACTCAAAGAAGAGTGCTGCAGAGAAGAATGGACCACCTAATC
JMSF030E14- ATGCATCAGTGTTGCTGAACTCAAAGAAGAGTGCTGCAGAGAAGAATGGACCACCTAATC
                      ____________________________________________________________
consensus ATGCATCAGTGTTGCTGAACTCAAAGAAGAGTGCTGCAGAGAAGAATGGACCACCTAATC
 
. : . : . : . : . : . :
JMSF009F03- TGTCCCTGCACGCATTCTATGTCATTGATGATGCAAAGAAAGCAGTGGAAGCAATCTGCC
JMSF005M01- TGTCCCTGCACGCATTCTATGTCATTGATGATGCAAAGAAAGCAGTGGAAGCAATCTGCC
JMSF030E14- TGTCCCTGCACGCATTCTATGTCATTGATGATGCAAAGAAAGCAGTGGAAGCAATCTGCC
                      ____________________________________________________________
consensus TGTCCCTGCACGCATTCTATGTCATTGATGATGCAAAGAAAGCAGTGGAAGCAATCTGCC
 
. : . : . : . : . : . :
JMSF009F03- C
JMSF005M01- CCGGTGTTGTCTCCTGTGCTGAT
JMSF030E14- CCGGTGTTGTCTCCTGTGCTGATATTTTGGCGTTTGCAGCAAGAGATGCTGTTGTCATAG
rJMSF030E14+ CTGATATTTNGGCGTTTGCAGCAAGAGATGCTGTTGTCATAG
rJMSF009F03+ TTTGGCGTTTGCAGCAAGAGATGCTGGTGTCATAG
                      ____________________________________________________________
consensus CCGGTGTTGTCTCCTGTGCTGATATTTTGGCGTTTGCAGCAAGAGATGCTGTTGTCATAG
 
. : . : . : . : . : . :
JMSF030E14- CTGGTGGGCCATACTGGGATGTCCCAAAAGGAAGAAAAGATGGGAGAGTATCAAAAGCCA
rJMSF030E14+ CTGGTGGGCCATACTGGGATGTCCCAAAAGGAAGAAAAGATGGGAGAGTATCAAAAGCCA
rJMSF009F03+ CTGGTGGGCCATACTGGGATGTCCCAAAAGGAAGAAAAGATGGGAGAGTATCAAAAGCCA
                      ____________________________________________________________
consensus CTGGTGGGCCATACTGGGATGTCCCAAAAGGAAGAAAAGATGGGAGAGTATCAAAAGCCA
 
. : . : . : . : . : . :
JMSF030E14- GTGAAACCACACAACTGCCAGGTCCAGCCTTCAACCTATCTCAACTGCAGAAGAGCTTCT
rJMSF030E14+ GTGAAACCACACAACTGCCAGGTCCAGCCTTCAACCTATCTCAACTGCAGAAGAGCTTCT
rJMSF009F03+ GTGAAACCACACAACTGCCAGGTCCAGCCTTCAACCTATCTCAACTGCAGAAGAGCTTCT
                      ____________________________________________________________
consensus GTGAAACCACACAACTGCCAGGTCCAGCCTTCAACCTATCTCAACTGCAGAAGAGCTTCT
 
. : . : . : . : . : . :
JMSF030E14- CACAGAGAGGTCTATCAATGGCAGACCTGGTGGCCCTCTCAGGTGGGCACACCATAGGCT
rJMSF030E14+ CACAGAGAGGTCTATCAATGGCAGACCTGGTGGCCCTCTCAGGTGGGCACACCATAGGCT
rJMSF009F03+ CACAGAGAGGTCTATCAATGGCAGACCTGGTGGCCCTCTCAGGTGGGCACACCATAGGCT
                      ____________________________________________________________
consensus CACAGAGAGGTCTATCAATGGCAGACCTGGTGGCCCTCTCAGGTGGGCACACCATAGGCT
 
. : . : . : . : . : . :
JMSF030E14- TCTCCCACTGTTCTTCC
rJMSF030E14+ TCTCCCACTGTTCTTCCTTCAACAACAGACTCCACAACTTCAATGCCACCCATGATGTTG
rJMSF009F03+ TCTCCCACTGTTCTTCCTTCAACAACAGACTCCACAACTTCAATGCCACCCATGATGTTG
                      ____________________________________________________________
consensus TCTCCCACTGTTCTTCCTTCAACAACAGACTCCACAACTTCAATGCCACCCATGATGTTG
 
. : . : . : . : . : . :
rJMSF030E14+ ATCCCACACTTCACCCCACCATTGCTGCCAACCTGAAAACCATCTGTCCCCTGAACAGCA
rJMSF005M03+ CAGCA
rJMSF009F03+ ATCCCACACTTCACCCCACCATTGCTGCCAACCTGAAAACCATCTGTCCCCTGAACAGCA
                      ____________________________________________________________
consensus ATCCCACACTTCACCCCACCATTGCTGCCAACCTGAAAACCATCTGTCCCCTGAACAGCA
 
. : . : . : . : . : . :
rJMSF030E14+ GATCCAAGAATGCAGGAACCAGCATGGACCCTTCTTCCACAACTTTTGACAACAACTATT
rJMSF005M03+ GATCCAAGAATGCAGGAACCAGCATGGACCCTTCTTCCACANCTTTTGACAACAACTATT
rJMSF009F03+ GATCCAAGAATGCAGGAACCAGCATGGACCCTTCTTCCACAACTTTTGACAACAACTATT
                      ____________________________________________________________
consensus GATCCAAGAATGCAGGAACCAGCATGGACCCTTCTTCCACAACTTTTGACAACAACTATT
 
. : . : . : . : . : . :
rJMSF030E14+ ACAAGCTAATTGTCCAGGGGAAAAGCCTCTTCTCCTCAGACCAGGCTTTGTTCACCAACC
rJMSF005M03+ ACAAGCTAATTGTCCAGGGGAAAAGCCTCTTCTCCTCAGACCAGGCTTTGTTCACCAACC
rJMSF009F03+ ACAAGCTAATTGTCCAGGGGAAAAGCCTCTTCTCCTCAGACCAGGCTTTGTTCACCAACC
                      ____________________________________________________________
consensus ACAAGCTAATTGTCCAGGGGAAAAGCCTCTTCTCCTCAGACCAGGCTTTGTTCACCAACC
 
. : . : . : . : . : . :
rJMSF030E14+ CAAACACCAAGTCCCTGGTTTTGCAGTATGCCAACTCAAAACAGGCTTTCTTTAAGGCTT
rJMSF005M03+ CAAACACCAAGTCCCTGGTTTTGCAGTATGCCAACTCAAAACAGGCTTTCTCTAAGGCTT
rJMSF009F03+ CAAACACCAAGTCCCTGGTTTTGCAGTATGCCAACTCAAAACAGGCTTTCTTTAAGGCTT
                      ____________________________________________________________
consensus CAAACACCAAGTCCCTGGTTTTGCAGTATGCCAACTCAAAACAGGCTTTCTTTAAGGCTT
 
. : . : . : . : . : . :
rJMSF030E14+ TTGCAAACTCCATGATCAAGATGAGCAGCATTACAGGAGGACAGGAAGTCAGAAAATATT
rJMSF005M03+ TNGCAAACTCCATGATCAAGATGAGCAGCATTACAGGAGGACAGGAAGTCAGAAAATATT
rJMSF009F03+ TTGCAAACTCCATGATCAAGATGAGCAGCATTACAGGAGGACAGGAAGTCAGAAAATATT
                      ____________________________________________________________
consensus TTGCAAACTCCATGATCAAGATGAGCAGCATTACAGGAGGACAGGAAGTCAGAAAATATT
 
. : . : . : . : . : . :
rJMSF030E14+ GCTGGATAGCTAATTAGATTAGCCTCCAAAGTTTATATCCTTTCTAGTGAGTGTAGATAG
rJMSF005M03+ GCTGGATAGCTAATTAGATTAGCCTCCAAAGTNTATATCCTTTCTAGTGAGTGTAGATAG
rJMSF009F03+ GCTGGATAGCTAATTAGATTAGCCTCCAAAGTTTATATCCTTTCTAGTGAGTGTAGATAG
                      ____________________________________________________________
consensus GCTGGATAGCTAATTAGATTAGCCTCCAAAGTTTATATCCTTTCTAGTGAGTGTAGATAG
 
. : . : . : . : . : . :
rJMSF030E14+ TCCAGCAAAATGGGCTGTCTTTCATATATAAATCTCATTTTCTTTCTTTACCTGCAGAGT
rJMSF005M03+ TCCAGCAAAATGGGCTGTCTTTCATATATAAATCTCATTTTCTTTCTTTACCTGCAGAGT
rJMSF009F03+ TCCAGCAAAATGGGCTGTCTTTCATATATAAATCTCATTTTCTTTCTTTACCTGCAGAGT
                      ____________________________________________________________
consensus TCCAGCAAAATGGGCTGTCTTTCATATATAAATCTCATTTTCTTTCTTTACCTGCAGAGT
 
. : . : . : . : . : . :
rJMSF030E14+ ATATGTAATGGATTGCAATAACTAAGATAATTAGTGGATTGCTTTACTCCCAAAATCAT
rJMSF005M03+ ATATGTAATGGATTGCAATAACTAAGATAATTAGTGG
rJMSF009F03+ ATATGTAATGGATTGCAATAACTAAGATAATTAGTGGATTGCTTTACTCCCAAAATCATT
                      ____________________________________________________________
consensus ATATGTAATGGATTGCAATAACTAAGATAATTAGTGGATTGCTTTACTCCCAAAATCATT