Previous Contig 011490:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012H04Sequence558011490 (2)gb:AY772719_16281750.008Ajellomyces capsulatus Sec31 mRNA, partial cds.
JMSF009D02Sequence661011490 (2)sp|Q9I9H8|APAF_BRARE0.009Apoptotic protease activating factor 1 (Apaf-1).>gb:AF251502_2482583 Danio rerio

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009D02+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
rJMFF012H04+ TCCAAACGAGTATGCCAGCATGAGGGCCCGAGCACAAACTTGTAACGGCGAAGAATTCA
rJMSF009D02+ ATCCAAACGAGTATGCCAGCATGAGGGCCCGAGCACAAACTTGTAACGGCGAAGAATTCA
                      ____________________________________________________________
consensus ATCCAAACGAGTATGCCAGCATGAGGGCCCGAGCACAAACTTGTAACGGCGAAGAATTCA
 
. : . : . : . : . : . :
rJMFF012H04+ GTNGGCTCTCTCCCGGCTTTNTGCAAAACAACCCCGGGATGAATCAGCCCGTGTTACACC
rJMSF009D02+ GTTGGCTCTCTCCCGGCTTTCTGCAAAACAACCCCGGGATGAATCAGCCCGTGTTACACC
                      ____________________________________________________________
consensus GTTGGCTCTCTCCCGGCTTTCTGCAAAACAACCCCGGGATGAATCAGCCCGTGTTACACC
 
. : . : . : . : . : . :
rJMFF012H04+ AACAAAACGCAAACTACTCGAGCTTCTTGCCATCTCGAGCTCAAGCCACACACGCATGGA
rJMSF009D02+ AACAAAACGCAAACTACTCGAGCTTCTTGCCATCTCGAGCTCAAGCCACACACGCATGGA
                      ____________________________________________________________
consensus AACAAAACGCAAACTACTCGAGCTTCTTGCCATCTCGAGCTCAAGCCACACACGCATGGA
 
. : . : . : . : . : . :
rJMFF012H04+ GGTCTAGCTCTCCACGACCAACAAGGGGTCCCACAATAGTTCCACCCGAAACATCTCCAA
rJMSF009D02+ GGTCTAGCTCTCCACGACCAACAAGGGGTCCCACAATAGTTCCACCCGAAACATCTCCAA
                      ____________________________________________________________
consensus GGTCTAGCTCTCCACGACCAACAAGGGGTCCCACAATAGTTCCACCCGAAACATCTCCAA
 
. : . : . : . : . : . :
rJMFF012H04+ GGAACAGAAACGCTACTTCCACACTCAATGTTCCAAGAACTCCTAGTTTTTCTTCGCGAC
rJMSF009D02+ GGAACAGAAACGCTACTTCCACACTCAATGTTCCAAGAACTCCTAGTTTTTCTTCGCGAC
                      ____________________________________________________________
consensus GGAACAGAAACGCTACTTCCACACTCAATGTTCCAAGAACTCCTAGTTTTTCTTCGCGAC
 
. : . : . : . : . : . :
rJMFF012H04+ CAAGCAGGACCACAGTCCCTTCATATTCGACCAGACCGTGGCTGGAAAGAACCCGGGTGC
rJMSF009D02+ CAAGCAGGACCACAGTCCCTTCATATTCGACCAGACCGTGGCTGGAAAGAACCCGGGTGC
                      ____________________________________________________________
consensus CAAGCAGGACCACAGTCCCTTCATATTCGACCAGACCGTGGCTGGAAAGAACCCGGGTGC
 
. : . : . : . : . : . :
rJMFF012H04+ CCTGCGCAAGGGCCATCGCCCCAGCTGTCCAAATCCGATCAGTCGTACCAGTATGTTCCG
rJMSF009D02+ CCTGCGCAAGGGCCATCGCCCCAGCTGTCCAAATCCGATCAGTCGTACCAGTATGTTCCG
                      ____________________________________________________________
consensus CCTGCGCAAGGGCCATCGCCCCAGCTGTCCAAATCCGATCAGTCGTACCAGTATGTTCCG
 
. : . : . : . : . : . :
rJMFF012H04+ CTCCCGCTCAGCGAGTTCCACCCGCCATCAGCCGGGACCCATCATCTTCCAAAGGCGACA
rJMSF009D02+ CTCCCGCTCAGCGAGTTCCACCCGCCATCAGCCGGGACCCATCATCTTCCAAAGGCGACA
                      ____________________________________________________________
consensus CTCCCGCTCAGCGAGTTCCACCCGCCATCAGCCGGGACCCATCATCTTCCAAAGGCGACA
 
. : . : . : . : . : . :
rJMFF012H04+ CCAGGAAAACCAAAGAAACTTCCGATGACATTTCAGCAGCAAGTTCAGAGTTTTCGAGGC
rJMSF009D02+ CCAGGAAAACCAAAGAAACTTCCGATGACATTTCAGCAGCAAGTTCAGAGTTTTCGAGGC
                      ____________________________________________________________
consensus CCAGGAAAACCAAAGAAACTTCCGATGACATTTCAGCAGCAAGTTCAGAGTTTTCGAGGC
 
. : . : . : . : . : . :
rJMFF012H04+ TCCAAATGTGAGTAATTC
rJMSF009D02+ TCCAAATGTGAGTAATTCGATCATGTTTTAGACGAGTCTTAAGGCAATTTCTGATAAACC
                      ____________________________________________________________
consensus TCCAAATGTGAGTAATTCGATCATGTTTTAGACGAGTCTTAAGGCAATTTCTGATAAACC
 
. : . : . : . : . : . :
rJMSF009D02+ GCATGCTTGCTTGTTCAAGTTACAAATAGCAAGAGAGAAAATGAATGNGAGAATAAGAGC
                      ____________________________________________________________
consensus GCATGCTTGCTTGTTCAAGTTACAAATAGCAAGAGAGAAAATGAATGNGAGAATAAGAGC