Previous Contig 011488:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009C10Sequence308005398 (4)761011488 (2)
JMSF013F17Sequence473005398 (4)687011488 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009C10+ TCTTAAGATATTGTTGGGAATTGAAAGAAGTTCCACCTACCTT
                      ____________________________________________________________
consensus TCTTAAGATATTGTTGGGAATTGAAAGAAGTTCCACCTACCTT
 
. : . : . : . : . : . :
rJMSF009C10+ TTCAAATATTGGAACGTTGAAGTTAATTGTGTTAGAATGTTGTTATTCTTCTCTTGTGAC
                      ____________________________________________________________
consensus TTCAAATATTGGAACGTTGAAGTTAATTGTGTTAGAATGTTGTTATTCTTCTCTTGTGAC
 
. : . : . : . : . : . :
rJMSF013F17+ GTTATTGTTTAAGGGAAAGGCAGGTTCTCCACTTCGTGTTTGTAAAGT
rJMSF009C10+ TTCTGCAGACAAGTTATTGTTTAAGGGAAAGGCAGGTTCTCCACTTCGTGTTTGTAAAGT
                      ____________________________________________________________
consensus TTCTGCAGACAAGTTATTGTTTAAGGGAAAGGCAGGTTCTCCACTTCGTGTTTGTAAAGT
 
. : . : . : . : . : . :
rJMSF013F17+ TGGAACTAAGGTNGAATTGCCTATTATTGAAAGATCTGAAGGAGAAAGTGTTGAAAGCTC
rJMSF009C10+ TGGAACTAAGGTTGAATTGCCTATTATTGAAAGATCTGAAGGAGAAAGTGTTGAAAGCTC
                      ____________________________________________________________
consensus TGGAACTAAGGTTGAATTGCCTATTATTGAAAGATCTGAAGGAGAAAGTGTTGAAAGCTC
 
. : . : . : . : . : . :
rJMSF013F17+ TGAAGAAGAAAGTATCGAAAGCTCTAAACAAAGATTGAAAGCTCGGAAGAGTGTGATGAA
rJMSF009C10+ TGAAGAAGAAAGTATCGAAAGCTCTAAACAAAGATTGAAAGCTCGGAAGAGTGTGATGAA
                      ____________________________________________________________
consensus TGAAGAAGAAAGTATCGAAAGCTCTAAACAAAGATTGAAAGCTCGGAAGAGTGTGATGAA
 
. : . : . : . : . : . :
rJMSF013F17+ ATATATGAAGAAGAAGGTGCCGAAATCTATGAATGCATTGAAAGAATTGACTGAGGAAAG
rJMSF009C10+ ATATATGAAGAAGAAGGTGCCGAAATCTATGAATGCATTGAAAGAATTGACTGAGGAAAG
                      ____________________________________________________________
consensus ATATATGAAGAAGAAGGTGCCGAAATCTATGAATGCATTGAAAGAATTGACTGAGGAAAG
 
. : . : . : . : . : . :
rJMSF013F17+ AAGAAAGTGACTTTATCTTTCAACGTGTAGGTTCCTGGCTCAACTTAATATGGTCCTCAT
rJMSF009C10+ AAGAAAGTGACTTTATCTTTCAACGTGTAGGTTCCTGGCTCAACTTAATATGGTCCTCAT
                      ____________________________________________________________
consensus AAGAAAGTGACTTTATCTTTCAACGTGTAGGTTCCTGGCTCAACTTAATATGGTCCTCAT
 
. : . : . : . : . : . :
rJMSF013F17+ TGCTGAATAAGTTGTGTGTTGCTTTCATGAGTTCTTGCATTGTCTAAATTAAAGTTGATG
rJMSF009C10+ TGCTGAATAAGTTGTGTGTTGCTTTCATGAGTTCTTGCATTGTCTAAATTAAAGTTGATG
                      ____________________________________________________________
consensus TGCTGAATAAGTTGTGTGTTGCTTTCATGAGTTCTTGCATTGTCTAAATTAAAGTTGATG
 
. : . : . : . : . : . :
rJMSF013F17+ AAGTTGATAATTAGTATACGCCACTTGTCCAGTTCAATCCTGATTGGTGGTGATCTGTCT
rJMSF009C10+ AAGTTGATAATTAGTATACGCCACTTGTCCAGTTCAATCCTGATTGGTGGTGATCTGTCT
                      ____________________________________________________________
consensus AAGTTGATAATTAGTATACGCCACTTGTCCAGTTCAATCCTGATTGGTGGTGATCTGTCT
 
. : . : . : . : . : . :
rJMSF013F17+ CGTTGGTTGGTAATTTGTGTAACCATGCATGTTGATATATTGAAGAAAGATGTTCATCAT
rJMSF009C10+ CGTTGGTTGGTAATTTGTGTAACCATGCATGTTGATATATTGAAGAAAGATGTTCATCAT
                      ____________________________________________________________
consensus CGTTGGTTGGTAATTTGTGTAACCATGCATGTTGATATATTGAAGAAAGATGTTCATCAT
 
. : . : . : . : . : . :
rJMSF013F17+ CCCGCTTTCGGGAGAAAACGAACAGAAAGGATTTCTTGCTGCAATTCCCCAGTCAACTTT
rJMSF009C10+ CCCGCTTTCGGGAGAAAACGAACAGAAAGGATTTCTTGCTGCAATTCCCCAGTCAACTTT
                      ____________________________________________________________
consensus CCCGCTTTCGGGAGAAAACGAACAGAAAGGATTTCTTGCTGCAATTCCCCAGTCAACTTT
 
. : . : . : . : . : . :
rJMSF013F17+ TCCAGTGAAGCTCAGTGGTGCACCAATATATGATGTATTTTTGGTTTCCATTTGATATGA
rJMSF009C10+ TCCAGTGAAGCTCAGTGGTGCACCAATATATGATGTATTTTTGGTTTCCATTTGATATGA
                      ____________________________________________________________
consensus TCCAGTGAAGCTCAGTGGTGCACCAATATATGATGTATTTTTGGTTTCCATTTGATATGA
 
. : . : . : . : . : . :
rJMSF013F17+ ACCAGTTCAACCTGTGTGTGTTATGATGTTTTTCTTCTCCAA
rJMSF009C10+ A-CAGTTCAA-CTGTGTGTGTTATGATGTTTTTCTTCTCCAATGACACCATGTCTCAGTG
                      ____________________________________________________________
consensus ACCAGTTCAACCTGTGTGTGTTATGATGTTTTTCTTCTCCAATGACACCATGTCTCAGTG