Previous Contig 011484:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016L01Sequence261011484 (4)sp|P82231|RRF_SPIOL7e-31Ribosome recycling factor, chloroplast precursor (Ribosome releasing factor, chl
JMFF016L02Sequence322002128 (3)131011484 (4)pir|S32716|S327162e-10ribosome releasing factor - carrot>gb:DCD2NLP_1675664 D.carota D2 mRNA for glyci
JMSF009A22Sequence318011484 (4)sp|P82231|RRF_SPIOL3e-04Ribosome recycling factor, chloroplast precursor (Ribosome releasing factor, chl764011484 (4)sp|P37706|RRF_DAUCA3e-80Ribosome recycling factor, chloroplast precursor (Ribosome releasing factor, chl

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF009A22- GCATTTAGTCGAACAAGTTTCGAGCATAAAATGGCAATGACTT
                      ____________________________________________________________
consensus GCATTTAGTCGAACAAGTTTCGAGCATAAAATGGCAATGACTT
 
. : . : . : . : . : . :
JMSF009A22- TCTCGCCGGCGGCTCATGTTCGTTCGCTCTACCCACAACGACCTGCCAACAAGCCTAACT
                      ____________________________________________________________
consensus TCTCGCCGGCGGCTCATGTTCGTTCGCTCTACCCACAACGACCTGCCAACAAGCCTAACT
 
. : . : . : . : . : . :
JMSF009A22- CTTCCAAACTCCTCCTTTCCCTTCGAGATGGTTATTCCACTTCAGCAAATGTTGCTTCAT
                      ____________________________________________________________
consensus CTTCCAAACTCCTCCTTTCCCTTCGAGATGGTTATTCCACTTCAGCAAATGTTGCTTCAT
 
. : . : . : . : . : . :
JMSF009A22- TGAGCGCGGCGTCGAATTATGTGAAATTGCAAATTTGTGCGAGGGAGCTTGCTATGAAGC
                      ____________________________________________________________
consensus TGAGCGCGGCGTCGAATTATGTGAAATTGCAAATTTGTGCGAGGGAGCTTGCTATGAAGC
 
. : . : . : . : . : . :
JMSF009A22- CTCTTGTCAAGCTATCAGGGAAGCAGAGAACTGGAGTGTTTAGGTGTGCAACCATAGAAG
rJMSF009A22+ GGGAAGCAGAGAACTGGAGTGTTTAGGTGTGCAACCATAGAAG
                      ____________________________________________________________
consensus CTCTTGTCAAGCTATCAGGGAAGCAGAGAACTGGAGTGTTTAGGTGTGCAACCATAGAAG
 
. : . : . : . : . : . :
JMSF009A22- AAATAGAAGCTGAAAAATCTTTTATTGAGGCAGAT
rJMFF016L01+ ATTGAGGCAGATGTTAAAGAAAGGATGGAAAAGACTA
rJMSF009A22+ AAATAGAAGCTGAAAAATCTTTTATTGAGGCAGATGTTAAAGAAAGGATGGAAAAGACTA
                      ____________________________________________________________
consensus AAATAGAAGCTGAAAAATCTTTTATTGAGGCAGATGTTAAAGAAAGGATGGAAAAGACTA
 
. : . : . : . : . : . :
rJMFF016L01+ TTGAGAATGTTAAGTCCAATTTCAACTCTATAAGGACAGGGAGAGCTAACCCTGCAATAT
rJMSF009A22+ TTGAGAATGTTAAGTCCAATTTCAACTCTATAAGGACAGGGAGAGCTAACCCTGCAATAT
                      ____________________________________________________________
consensus TTGAGAATGTTAAGTCCAATTTCAACTCTATAAGGACAGGGAGAGCTAACCCTGCAATAT
 
. : . : . : . : . : . :
rJMFF016L01+ TGGATAAAGTTGAGGTGGAGTATTATGGTACTCCAGTCAGCTTGAAGAGCATAGCTCAAA
rJMSF009A22+ TGGATAAAGTTGAGGTGGAGTATTATGGTACTCCAGTCAGCTTGAAGAGCATAGCTCAAA
                      ____________________________________________________________
consensus TGGATAAAGTTGAGGTGGAGTATTATGGTACTCCAGTCAGCTTGAAGAGCATAGCTCAAA
 
. : . : . : . : . : . :
rJMFF016L01+ TTAGCACTCCTGATGCAAGTTCTCTCCCTGGTACAG-CCTATGACAAATCCAGCCTAAAA
rJMSF009A22+ TTAGCACTCCTGATGCAAGTTCTCT-CCTGGTACAGCCCTATGACAAATCCAGCCTAAAA
                      ____________________________________________________________
consensus TTAGCACTCCTGATGCAAGTTCTCTCCCTGGTACAGCCCTATGACAAATCCAGCCTAAAA
 
. : . : . : . : . : . :
rJMFF016L01+ GCTATAGAGAAGGCCATTGTCACCTCTGATCTTGGTATGACTCCT
rJMFF016L02+ CTGATGGAGAA
rJMSF009A22+ GCTATAGAGAAGGCCATTGTCACCTCTGATCTTGGTATGACTCCTAATTCTGATGGAGAA
                      ____________________________________________________________
consensus GCTATAGAGAAGGCCATTGTCACCTCTGATCTTGGTATGACTCCTAATTCTGATGGAGAA
 
. : . : . : . : . : . :
rJMFF016L02+ GTGATANGATNAGCTCTCCCTCANCNGACAGCTGAAAGGAGGAAGGAGTTGTCAAAAGTT
rJMSF009A22+ GTGATAAGATTAGCTCTCCCTCAACTGACAGCTGAAAGGAGGAAGGAGTTGTCAAAAGTT
                      ____________________________________________________________
consensus GTGATAAGATTAGCTCTCCCTCAACTGACAGCTGAAAGGAGGAAGGAGTTGTCAAAAGTT
 
. : . : . : . : . : . :
rJMFF016L02+ NTGGCCAAGCAGGCTGAGGAAGGAAAGGTAGCTATTAGGAATATAAGAAGGGATGCCTTG
rJMSF009A22+ GTGGCCAAGCAGGCTGAGGAAGGAAAGGTAGCTATTAGGAATATAAGAAGGGATGCCTTG
                      ____________________________________________________________
consensus GTGGCCAAGCAGGCTGAGGAAGGAAAGGTAGCTATTAGGAATATAAGAAGGGATGCCTTG
 
. : . : . : . : . : . :
rJMSF009A22+ AAATCCTATGAAAAACTTGAGAAGGAGAAAAAGCTATCTGAGGACAATGTAAAGGATCTG
                      ____________________________________________________________
consensus AAATCCTATGAAAAACTTGAGAAGGAGAAAAAGCTATCTGAGGACAATGTAAAGGATCTG
 
. : . : . : . : . : . :
rJMSF009A22+ TCTAGTGATTTGCAGAAAGTGACTGATGAGTACATGAAGAAAATTGATAGTATCTACAAG
                      ____________________________________________________________
consensus TCTAGTGATTTGCAGAAAGTGACTGATGAGTACATGAAGAAAATTGATAGTATCTACAAG
 
. : . : . : . : . : . :
rJMSF009A22+ CAAAAGGAGAAGGAGTTGTTGACAGTTTAGAAGCCGGTTTTGTACAAGATGTAAATTGAG
                      ____________________________________________________________
consensus CAAAAGGAGAAGGAGTTGTTGACAGTTTAGAAGCCGGTTTTGTACAAGATGTAAATTGAG
 
. : . : . : . : . : . :
rJMSF009A22+ TTCTGCTGCAAATGTACTTTTCCCGATATCTGAGTGCATGTTGAGTAATTGAGCGTGTTT
                      ____________________________________________________________
consensus TTCTGCTGCAAATGTACTTTTCCCGATATCTGAGTGCATGTTGAGTAATTGAGCGTGTTT
 
. : . : . : . : . : . :
rJMSF009A22+ GTGTTTCAAATTGATAAATTTGTACACTTGTTTTCAAAATTTTAATGATAAAGGGGGGCG
                      ____________________________________________________________
consensus GTGTTTCAAATTGATAAATTTGTACACTTGTTTTCAAAATTTTAATGATAAAGGGGGGCG