Previous Contig 011483:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009A20Sequence282006631 (2)816011483 (2)gb:AY092958_15749121e-90Arabidopsis thaliana GTP-binding protein LepA homolog (At5g08650) mRNA, complete
JMSF029P03Sequence607006631 (2)gb:AY092958_15749123e-54Arabidopsis thaliana GTP-binding protein LepA homolog (At5g08650) mRNA, complete709011483 (2)gb:AY092958_15749121e-72Arabidopsis thaliana GTP-binding protein LepA homolog (At5g08650) mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009A20+ AAGAAAGTCCATTGNGGNACCATATGTCAAGATTGA
                      ____________________________________________________________
consensus AAGAAAGTCCATTGNGGNACCATATGTCAAGATTGA
 
. : . : . : . : . : . :
rJMSF009A20+ GATGCTCACTCCAAAAGAATACATTGGTGCACTAATGGAGCTTGCTCAAGACAGAAGAGG
                      ____________________________________________________________
consensus GATGCTCACTCCAAAAGAATACATTGGTGCACTAATGGAGCTTGCTCAAGACAGAAGAGG
 
. : . : . : . : . : . :
rJMSF029P03+ CAAAGAAATGAAATTTATTGCTGAAAATAGAGCTTCAATTATATATGAATTGCC
rJMSF009A20+ AGAGTTCAAAGAAATGAAATTTATTGCTGAAAATAGAGCTTCAATTATATATGAATTGCC
                      ____________________________________________________________
consensus AGAGTTCAAAGAAATGAAATTTATTGCTGAAAATAGAGCTTCAATTATATATGAATTGCC
 
. : . : . : . : . : . :
rJMSF029P03+ ACCTGCTGAGATGGTTGGTGATTTCTTTGATCAACTGAAATCAAGAAGCAAAGGTTATGC
rJMSF009A20+ ACTTGCTGAGATGGTTGGTGATTTCTTTGATCAACTGAAATCAAGAAGCAAAGGTTATGC
                      ____________________________________________________________
consensus ACTTGCTGAGATGGTTGGTGATTTCTTTGATCAACTGAAATCAAGAAGCAAAGGTTATGC
 
. : . : . : . : . : . :
rJMSF029P03+ TAGCATGGAGTACAATTTTATTGGATACAAAGAAAGTGATTTGATAAAGCTTGATATTCT
rJMSF009A20+ TAGCATGGAGTACAATTTTATTGGATACAAAGAAAGTGATTTGATAAAGCTTGATATTCT
                      ____________________________________________________________
consensus TAGCATGGAGTACAATTTTATTGGATACAAAGAAAGTGATTTGATAAAGCTTGATATTCT
 
. : . : . : . : . : . :
rJMSF029P03+ TATTAATGGTGACCCTGTGGAACCTTTGTCAACTATTGTGCACAAGGACAAGGCATATGG
rJMSF009A20+ TATTAATGGTGACCCTGTGGAACCTTTGTCAACTATTGTGCACAAGGACAAGGCATATGG
                      ____________________________________________________________
consensus TATTAATGGTGACCCTGTGGAACCTTTGTCAACTATTGTGCACAAGGACAAGGCATATGG
 
. : . : . : . : . : . :
rJMSF029P03+ AGTGGGAAGGGCCTTGACTCAAAAGCTGAAAGAACTAATACCTAGACAAATGTTTAAAGT
rJMSF009A20+ AGTGGGAAGGGCCTTGACTCAAAAGCTGAAAGAACTAATACCTAGACAAATGTTTAAAGT
                      ____________________________________________________________
consensus AGTGGGAAGGGCCTTGACTCAAAAGCTGAAAGAACTAATACCTAGACAAATGTTTAAAGT
 
. : . : . : . : . : . :
rJMSF029P03+ TCCAATCCAGGCATGCATAGGCTCCAAAGTCATTGCCAGTGAGGCTTTGTCTGCTATCAG
rJMSF009A20+ TCCAATCCAGGCATGCATAGGCTCCAAAGTCATTGCCAGTGAGGCTTTGTCTGCTATCAG
                      ____________________________________________________________
consensus TCCAATCCAGGCATGCATAGGCTCCAAAGTCATTGCCAGTGAGGCTTTGTCTGCTATCAG
 
. : . : . : . : . : . :
rJMSF029P03+ GAAGGATGTTCTTGCCAAGTGCTATGGTGGTGACATTTCAAGAAAAAAGAAGTTGCTTAA
rJMSF009A20+ GAAGGATGTTCTTGCCAAGTGCTATGGTGGTGACATTTCAAGAAAAAAGAAGTTGCTTAA
                      ____________________________________________________________
consensus GAAGGATGTTCTTGCCAAGTGCTATGGTGGTGACATTTCAAGAAAAAAGAAGTTGCTTAA
 
. : . : . : . : . : . :
rJMSF029P03+ GAAACAGGCCGAGGGGAAGAAAAGAATGAAGTCAATTGGTAAAGTTGATGTACCTCAGGA
rJMSF009A20+ GAAACAGGCCGAGGGGAAGAAAAGAATGAAGTCAATTGGTAAAGTTGATGTACCTCAGGA
                      ____________________________________________________________
consensus GAAACAGGCCGAGGGGAAGAAAAGAATGAAGTCAATTGGTAAAGTTGATGTACCTCAGGA
 
. : . : . : . : . : . :
rJMSF029P03+ AGCATTTATGGCAGTTCTCAAACTTGAGAAAGAGGTCCTATGATTGCATCAGTGCAGCGG
rJMSF009A20+ AGCATTTATGGCAGTTCTCAAACTTGAGAAAGAGGTCCTATGATTGCATCAGTGCAGCGG
                      ____________________________________________________________
consensus AGCATTTATGGCAGTTCTCAAACTTGAGAAAGAGGTCCTATGATTGCATCAGTGCAGCGG
 
. : . : . : . : . : . :
rJMSF029P03+ AGGGCGATGTAGAATCAGTGCCCATCTTCTTGTAAAATTCTTTTTTCTTCATATTTTTTC
rJMSF009A20+ AGGGCGATGTAGAATCAGTGCCCATCTTCTTGTAAAATTCTTTTTTCTTCATATTTTTTC
                      ____________________________________________________________
consensus AGGGCGATGTAGAATCAGTGCCCATCTTCTTGTAAAATTCTTTTTTCTTCATATTTTTTC
 
. : . : . : . : . : . :
rJMSF029P03+ GACACAACCAAATTGTAAAAGGCATCAGATATCTTCTTGGTGATCAAGCAAAGATTCATG
rJMSF009A20+ GACACAACCAAATTGTAAAAGGCATCAGATATCTTCTTGGTGATCAAGCAAAGATTCATG
                      ____________________________________________________________
consensus GACACAACCAAATTGTAAAAGGCATCAGATATCTTCTTGGTGATCAAGCAAAGATTCATG
 
. : . : . : . : . : . :
rJMSF029P03+ TACATCATATGGCAGGCTTCATGGATTGGAAATTTGATGTAAATACAAACAGCAT
rJMSF009A20+ TACATCATATGGCAGGCTTCATGGATTGGAAATTTGATGTAAATACAAACAGCATTTTGA
                      ____________________________________________________________
consensus TACATCATATGGCAGGCTTCATGGATTGGAAATTTGATGTAAATACAAACAGCATTTTGA