Previous Contig 011482:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031O16Sequence593011482 (9)gb:AY084908_15699908e-55Arabidopsis thaliana clone 120982 mRNA, complete sequence.786011482 (9)gb:AY084908_15699903e-80Arabidopsis thaliana clone 120982 mRNA, complete sequence.
JMFF037O12Sequence586011482 (9)gb:AY084908_15699904e-53Arabidopsis thaliana clone 120982 mRNA, complete sequence.716011482 (9)gb:AY084908_15699902e-69Arabidopsis thaliana clone 120982 mRNA, complete sequence.
JMSF009A10Sequence244011482 (9)767011482 (9)gb:AY084908_15699909e-75Arabidopsis thaliana clone 120982 mRNA, complete sequence.
JMSF025N16Sequence686011482 (9)gb:AY084908_15699906e-62Arabidopsis thaliana clone 120982 mRNA, complete sequence.714023192gb:AP005647_18554110.011Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMSF031A01Sequence535011482 (9)gb:AY084908_15699909e-15Arabidopsis thaliana clone 120982 mRNA, complete sequence.715011482 (9)gb:AY084908_15699908e-73Arabidopsis thaliana clone 120982 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF009A10- CCCACGTGGGAAGCCTCTCCGCCGGCCACAT
JMSF031A01- GGTAATCAGGTAACCCACGTGGGAAGCCTCTCCGCCGGCCACAT
                      ____________________________________________________________
consensus GGTAATCAGGTAACCCACGTGGGAAGCCTCTCCGCCGGCCACAT
 
. : . : . : . : . : . :
JMSF009A10- CTCCATTTCGGCATTCCCCTTTTTCTCCCGAAATTGCTTCTCTACCACGCCACTTCCCTA
JMSF031A01- CTCCATTTCGGCATTCCCCTTTTTCTCCCGAAATTGCTTCTCTACCACGCCACTTCCCTA
                      ____________________________________________________________
consensus CTCCATTTCGGCATTCCCCTTTTTCTCCCGAAATTGCTTCTCTACCACGCCACTTCCCTA
 
. : . : . : . : . : . :
JMSF009A10- ATCATTGCTTTAAATTTCAATAAATATTTTTTTATAAAAAAAAATTCCTGTAAAAATATA
JMSF031A01- ATCATTGCTTTAAATTTCAATAAATATTTTTTTATAAAAAAAAATTCCTGTAAAAATATA
JMSF025N16+ TAAAAAAAAATTCCTGTAAAAATATA
                      ____________________________________________________________
consensus ATCATTGCTTTAAATTTCAATAAATATTTTTTTATAAAAAAAAATTCCTGTAAAAATATA
 
. : . : . : . : . : . :
JMSF009A10- TGCATATACCTGTCGGTAAATGTTTATCGTTACTGCAAAATCCTTTTCGCAGTGAATTGA
JMSF031A01- TGCATATACCTGTCGGTAAATGTTTATCGTTACTGCAAAATCCTTTTCGCAGTGAATTGA
JMFF037O12- GTTATTGCAAAATCCTTTTCGCAGTGAATTGA
JMFF031O16- GTTATTGCAAAATCCTTTTCGCAGTGAATTGA
JMSF025N16+ TGCATATACCTGTCGGTAAATGTTTATCGTTACTGCAAAATCCTTTTCGCAGTGAATTGA
                      ____________________________________________________________
consensus TGCATATACCTGTCGGTAAATGTTTATCGTTACTGCAAAATCCTTTTCGCAGTGAATTGA
 
. : . : . : . : . : . :
JMSF009A10- ATTGAAGATACATATATTGGCAAAGGCATG
JMSF031A01- ATTGAAGATACATATATTGGCAAAGGCATGTTTGGATGGGAGAGTTGCAGGGATCGTTGC
JMFF037O12- ATTGAAGATACATATATTGGCAAAGGCATGTTTGGATGGGAGAGTTGCAGGGATCGTTGC
JMFF031O16- ATTGAAGATACATATATTGGCAAAGGCATGTTTGGATGGGAGAGTTGCAGGGATCGTTGC
JMSF025N16+ ATTGAAGATACATATATTGGCAAAGGCATGTTTGGATGGGAGAGTTGCAGGGATCGTTGC
                      ____________________________________________________________
consensus ATTGAAGATACATATATTGGCAAAGGCATGTTTGGATGGGAGAGTTGCAGGGATCGTTGC
 
. : . : . : . : . : . :
JMSF031A01- GCCTTTTCTGATGCTCAAATGTCTCGGAGAATCCAAGCTTGATCAAACATGCCTCCGGTT
JMFF037O12- GCCTTTTCTGATGCTCAAATGTCTCGGAGAATCCAAGCTTGATCAAACATGCCTCCGGTT
JMFF031O16- GCCTTTTCTGATGCTCAAATGTCTCGGAGAATCCAAGCTTGATCAAACATGCCTCCGGTT
JMSF025N16+ GCCTTTTCTGATGCTCAAATGTCTCGGAGAATCCAAGCTTGATCAAACATGCCTCCGGTT
                      ____________________________________________________________
consensus GCCTTTTCTGATGCTCAAATGTCTCGGAGAATCCAAGCTTGATCAAACATGCCTCCGGTT
 
. : . : . : . : . : . :
JMSF031A01- TCAACGCCTCGAAACTCAGCTTACCTCACTGCTCTCACCCAGGAGATCGAGAAGAAGCTT
JMFF037O12- TCAACGCCTCGAAACTCAGCTTACCTCACTGCTCTCACCCAGGAGATCGAGAAGAAGCTT
JMFF031O16- TCAACGCCTCGAAACTCAGCTTACCTCACTGCTCTCACCCAGGAGATCGAGAAGAAGCTT
JMSF025N16+ TCAACGCCTCGAAACTCAGCTTACCTCACTGCTCTCACCCAGGAGATCGAGAAGAAGCTT
                      ____________________________________________________________
consensus TCAACGCCTCGAAACTCAGCTTACCTCACTGCTCTCACCCAGGAGATCGAGAAGAAGCTT
 
. : . : . : . : . : . :
JMSF031A01- CAACGCGCATTGACCTCGCCGTCTCAGAGGCGCGATTTGTTGCAGCAGCTATTCGCGGAC
JMFF037O12- CAACGCGCATTGACCTCGCCGTCTCAGAGGCGCGATTTGTTGCAGCAGCTATTCGCGGAC
JMFF031O16- CAACGCGCATTGACCTCGCCGTCTCAGAGGCGCGATTTGTTGCAGCAGCTATTCGCGGAC
JMSF025N16+ CAACGCGCATTGACCTCGCCGTCTCAGAGGCGCGATTTGTTGCGGCAGCTATTCGCGGAC
                      ____________________________________________________________
consensus CAACGCGCATTGACCTCGCCGTCTCAGAGGCGCGATTTGTTGCAGCAGCTATTCGCGGAC
 
. : . : . : . : . : . :
JMSF031A01- ATAGCTTTGGAAGTTGATGATCGAGCAAAAGAAATAATTTTTGGCAGTGAAGATGTAATA
JMFF037O12- ATAGCTTTGGAAGTTGATGATCGAGCAAAAGAAATAATTTTTGGCAGTGAAGATGTAATA
JMFF031O16- ATAGCTTTGGAAGTTGATGATCGAGCAAAAGAAATAATTTTTGGCAGTGAAGATGTAATA
JMSF025N16+ ATAGCTTTGGAAGTTGATGATCGAGCAAAAGAAATAATTTTTGGCAGTGAAGATGTAATA
                      ____________________________________________________________
consensus ATAGCTTTGGAAGTTGATGATCGAGCAAAAGAAATAATTTTTGGCAGTGAAGATGTAATA
 
. : . : . : . : . : . :
JMSF031A01- TCTGCCGCAGA
JMFF037O12- TCTGCCGCAGAGGAAAGGATAGAAGGCCCAATATGTTTTTATGATGTACTTGCTGACCAT
JMFF031O16- TCTGCCGCAGAGGAAAGGATAGAAGGCCCAATATGTTTTTATGATGTACTTGCTGACCAT
JMSF025N16+ TCTGCCGCAGAGGAAAGGATAGAAGGCCCAATATGTTTTTATGATGTACTTGCTGACCAT
                      ____________________________________________________________
consensus TCTGCCGCAGAGGAAAGGATAGAAGGCCCAATATGTTTTTATGATGTACTTGCTGACCAT
 
. : . : . : . : . : . :
JMFF037O12- TTCATCCTAGTACCCCACAATGGGAAAGCAATCCTTGATTTGATTGTTCAACTATGGAGC
JMFF031O16- TTCATCCTAGTACCCCACAATGGGAAAGCAATCCTTGATTTGATTGTTCAACTATGGAGC
JMSF025N16+ TTCATCCTAGTACCCCACAATGGGAAAGCAATCCTTGATTTGATTGTTCAACTATGGAGC
                      ____________________________________________________________
consensus TTCATCCTAGTACCCCACAATGGGAAAGCAATCCTTGATTTGATTGTTCAACTATGGAGC
 
. : . : . : . : . : . :
JMFF037O12- CAGTCCTTTTGTTCTAATATCTTTACTCTTTTGTTTCACAAGTGGTTGTTCGAGGTTGAA
JMFF031O16- CAGTCCTTTTGTTCTAATATCTTTACTCTTTTGTTTCACAAGTGGTTGTTCGAGGTTGAA
JMSF025N16+ CAGTCCTTTTGTTCTAATATCTTTACTCTTTTGTTTCACAAGTGGTTGTTCGAGGTTGAA
                      ____________________________________________________________
consensus CAGTCCTTTTGTTCTAATATCTTTACTCTTTTGTTTCACAAGTGGTTGTTCGAGGTTGAA
 
. : . : . : . : . : . :
JMFF037O12- CTTGACAATTCTGAAGTCCTTCTCCGGTACTCTTCAGCTCTTGTTCAAGGTGCTACTAAT
JMFF031O16- CTTGACAATTCTGAAGTCCTTCTCCGGTACTCTTCAGCTCTTGTTCAAGGTGCTACTAAT
JMSF025N16+ CTTGACAATTCTGAAGTCCTTCTCCGGTACTCTTCAGCTCTTGTTCAAGGTGCTACTAAT
                      ____________________________________________________________
consensus CTTGACAATTCTGAAGTCCTTCTCCGGTACTCTTCAGCTCTTGTTCAAGGTGCTACTAAT
 
. : . : . : . : . : . :
JMFF037O12- GTATTCTGGATTGA
JMFF031O16- GTATTCTGGATTGA
JMSF025N16+ GTATTCTGGATTGATATCCAAACCAACACAAGGCGCTTTCAGAGTCTCTTTCGGTATCTT
rJMFF031O16+ TGATATCCAAACCAACACAAGGCGCTTTCAGAGTCTCTTTCGGTATCTT
                      ____________________________________________________________
consensus GTATTCTGGATTGATATCCAAACCAACACAAGGCGCTTTCAGAGTCTCTTTCGGTATCTT
 
. : . : . : . : . : . :
rJMFF031O16+ CTCGAGGAAGTTTCTCTTGATCCTGATCGGTTAAAGAAGATACCCTTGCAGGTCTAACAT
                      ____________________________________________________________
consensus CTCGAGGAAGTTTCTCTTGATCCTGATCGGTTAAAGAAGATACCCTTGCAGGTCTAACAT
 
. : . : . : . : . : . :
rJMFF037O12+ GTGCAGCAGAGTTTGTTTCTCCTCCTTTCAAGGTTCCTATTTTTCTATGACTCAG
rJMSF031A01+ GTGCAGCAGAGTTTGTTTCTCCTCCTTTCAAGGTTCCTATTTTTCTATGACTCAG
rJMFF031O16+ TTAAAGTGCAGCAGAGTTTGTTTCTCCTCCTTTCAAGGTTCCTATTTTTCTATGACTCAG
rJMSF009A10+ GTGCAGCAGAGTTTGTTTCTCCTCCTTTCAAGGTTCCTATTTTTCTATGACTCAG
                      ____________________________________________________________
consensus TTAAAGTGCAGCAGAGTTTGTTTCTCCTCCTTTCAAGGTTCCTATTTTTCTATGACTCAG
 
. : . : . : . : . : . :
rJMFF037O12+ TTGAAAAGCTAGAAAGCTTCTTGAAGCAATTTCCTGATTATCCGAATTCTTTCTTGATTG
rJMSF031A01+ TTGAAAAGCTAGAAAGCTTCTTGAAGCAATTTCCTGATTATCCGAATTCTTTCTTGATTG
rJMFF031O16+ TTGAAAAGCTAGAAAGCTTCTTGAAGCAATTTCCTGATTATCCGAATTCTTTCTTGATTG
rJMSF009A10+ TTGGAAAGCTAGAAAGCTTCTTGAAGCAATTTCCTGATTATCCGAATTCTTTCTTGATTG
                      ____________________________________________________________
consensus TTGAAAAGCTAGAAAGCTTCTTGAAGCAATTTCCTGATTATCCGAATTCTTTCTTGATTG
 
. : . : . : . : . : . :
rJMFF037O12+ GTGGTCCAGCTGATATTTTTGTTACGGAATTAGCTGATCAGCTTCAGAAATTAAAGGTCG
rJMSF031A01+ GTGGTCCAGCTGATATTTTTGTTACGGAATTAGCTGATCAGCTTCAGAAATTAAAGGTCG
rJMFF031O16+ GTGGTCCAGCTGATATTTTTGTTACGGAATTAGCTGATCAGCTTCAGAAATTAAAGGTCG
rJMSF009A10+ GTGGTCCAGCTGATATTTTTGTTACGGAATTAGCTGATCAGCTTCAGAAATTAAAGGTCG
                      ____________________________________________________________
consensus GTGGTCCAGCTGATATTTTTGTTACGGAATTAGCTGATCAGCTTCAGAAATTAAAGGTCG
 
. : . : . : . : . : . :
rJMFF037O12+ AGCCAGTGCTATTGTATTACCTCTCTCAGACAAAAGTTCTCAGTGGATTAGAATTGAGAA
rJMSF031A01+ AGCCAGTGCTATTGTATTACCTCTCTCAGACAAAAGTTCTCAGTGGATTAGAATTGAGAA
rJMFF031O16+ AGCCAGTGCTATTGTATTACCTCTCTCAGACAAAAGTTCTCAGTGGATTAGAATTGAGAA
rJMSF009A10+ AGCCAGTGCTATTGTATTACCTCTCTCAGACAAAAGTTCTCAGTGGATTAGAATTGAGAA
                      ____________________________________________________________
consensus AGCCAGTGCTATTGTATTACCTCTCTCAGACAAAAGTTCTCAGTGGATTAGAATTGAGAA
 
. : . : . : . : . : . :
rJMFF037O12+ TGGCGACAAGTACAAGGCTTAAAACTTGCCTGTACAGCTTCACGAGCCCTGGAGCTCCCA
rJMSF031A01+ TGGCGACAAGTACAAGGCTTAAAACTTGCCTGTACAGCTTCACGAGCCCTGGAGCTCCCA
rJMFF031O16+ TGGCGACAAGTACAAGGCTTAAAACTTGCCTGTACAGCTTCACGAGCCCTGGAGCTCCCA
rJMSF009A10+ TGGCGACAAGTACAAGGCTTAAAACTTGCCTGTACAGCTTCACGAGCCCTGGAGCTCCCA
                      ____________________________________________________________
consensus TGGCGACAAGTACAAGGCTTAAAACTTGCCTGTACAGCTTCACGAGCCCTGGAGCTCCCA
 
. : . : . : . : . : . :
rJMFF037O12+ TGTATCCAACACGAGCTGTTCGTCATGCTGCATGGAATGCACTCAATCTACTTTTTCCTG
rJMSF031A01+ TGTATCCAACACGAGCTGTTCGTCATGCTGCATGGAATGCACTCAATCTACTTTTTCCTG
rJMFF031O16+ TGTATCCAACACGAGCTGTTCGTCATGCTGCATGGAATGCACTCAATCTACTTTTTCCTG
rJMSF009A10+ TGTATCCAACACGAGCTGTTCGTCATGCTGCATGGAATGCACTCAATCTACTTTTTCCTG
                      ____________________________________________________________
consensus TGTATCCAACACGAGCTGTTCGTCATGCTGCATGGAATGCACTCAATCTACTTTTTCCTG
 
. : . : . : . : . : . :
rJMFF037O12+ TTGGGAGATATCCTCGGCACCTTATAAGCCTCTTCTTTCGCTTGCTATACCCGTGGTACT
rJMSF031A01+ TTGGGAGATATCCTCGGCACCTTATAAGCCTCTTCTTTCGCTTGCTATACCCGTGGTACT
rJMFF031O16+ TTGGGAGATATCCTCGGCACCTTATAAGCCTCTTCTTTCGCTTGCTATACCCGTGGTACT
rJMSF009A10+ TTGGGAGATATCCTCGGCACCTTATAAGCCTCTTCTTTCGCTTGCTATACCCGTGGTACT
                      ____________________________________________________________
consensus TTGGGAGATATCCTCGGCACCTTATAAGCCTCTTCTTTCGCTTGCTATACCCGTGGTACT
 
. : . : . : . : . : . :
rJMFF037O12+ GGCCTGCTTCGTGTTGGAACTTCATAAAGTCATGCATAATAGCGGTATTATATTCAATAC
rJMSF031A01+ GGCCTGCTTCGTGTTGGAACTTCATAAAGTCATGCATAATAGCGGTATTATATTCAATAC
rJMFF031O16+ GGCCTGCTTCGTGTTGGAACTTCATAAAGTCATGCATAATAGCGGTATTATATTCAATAC
rJMSF009A10+ GGCCTGCTTCGTGTTGGAACTTCATAAAGTCATGCATAATAGCGGTATTATATTCAATAC
                      ____________________________________________________________
consensus GGCCTGCTTCGTGTTGGAACTTCATAAAGTCATGCATAATAGCGGTATTATATTCAATAC
 
. : . : . : . : . : . :
rJMFF037O12+ TGAGATTGATTTTCTCTGGTTGGGAAAAATTAACAAAAAGAAGGGTAAATCCAGAATGAT
rJMSF031A01+ TGAGATTGATTTTCTCTGGTTGGGAAAAATTAACAAAAAGAAGGGTAAATCCAGAATGAT
rJMFF031O16+ TGAGATTGATTTTCTCTGGTTGGGAAAAATTAACAAAAAGAAGGGTAAATCCAGAATGAT
rJMSF009A10+ TGAGATTGATTTTCTCTGGTTGGGAAAAATTAACAAAAAGAAGGGTAAATCCAGAATGAT
                      ____________________________________________________________
consensus TGAGATTGATTTTCTCTGGTTGGGAAAAATTAACAAAAAGAAGGGTAAATCCAGAATGAT
 
. : . : . : . : . : . :
rJMFF037O12+ TGATTGTCTGTGAGGGTGTTTGTTTTGTTGTAAGCTGGGAAAAATGGTTAGTTGTAGGAA
rJMSF031A01+ TGATTGTCTGTGAGGGTGTTTGTTTTGTTGTAAGCTGGGAAAAATGGTTAGTTGTAGGAA
rJMFF031O16+ TGATTGTCTGTGAGGGTGTTTGTTTTGTTGTAAGCTGGGAAAAATGGTTAGTTGTAGGAA
rJMSF009A10+ TGATTGTCTGTGAGGGTGTTTGTTTTGTTGTAAGCTGGGAAAAATGGTTAGTTGTAGGAA
                      ____________________________________________________________
consensus TGATTGTCTGTGAGGGTGTTTGTTTTGTTGTAAGCTGGGAAAAATGGTTAGTTGTAGGAA
 
. : . : . : . : . : . :
rJMFF037O12+ CAGCTTTTGTATTGTAGTATAGTAGGTAGCTGCACTGTTAACTGAGATTTCCAGTCTGTA
rJMSF031A01+ CAGCTTTTGTATTGTAGTATAGTAGGTAGCTGCACTGTTAACTGAGATTTCCAGTCTGTA
rJMFF031O16+ CAGCTTTTGTATTGTAGTATAGTAGGTAGCTGCACTGTTAACTGAGATTTCCAGTCTGTA
rJMSF009A10+ CAGCTTTTGTATTGTAGTATAGTAGGTAGCTGCACTGTTAACTGAGATTTCCAGTCTGTA
                      ____________________________________________________________
consensus CAGCTTTTGTATTGTAGTATAGTAGGTAGCTGCACTGTTAACTGAGATTTCCAGTCTGTA
 
. : . : . : . : . : . :
rJMFF037O12+ ATCATCATAAACAACGC
rJMSF031A01+ ATCATCAT
rJMFF031O16+ ATCATCATAAACAACGC
rJMSF009A10+ ATCATCATAAACAACGCTAGTGATGTGTTATTTCCATGATTGTTTCTTTGTTGCTGAACG
                      ____________________________________________________________
consensus ATCATCATAAACAACGCTAGTGATGTGTTATTTCCATGATTGTTTCTTTGTTGCTGAACG