Previous Contig 011479:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS110E07Sequence651011479 (6)pir|T04125|T04125e-110protein kinase PK12 (EC 2.7.1.-), ethylene-induced - common tobacco>gb:NTU73937_
JMSF008P14Sequence227011479 (6)pir|T04125|T041252e-15protein kinase PK12 (EC 2.7.1.-), ethylene-induced - common tobacco>gb:NTU73937_734011479 (6)pir|T04125|T041253e-50protein kinase PK12 (EC 2.7.1.-), ethylene-induced - common tobacco>gb:NTU73937_
JMSF040A02Sequence656011479 (6)pir|T04125|T041258e-84protein kinase PK12 (EC 2.7.1.-), ethylene-induced - common tobacco>gb:NTU73937_906011479 (6)pir|T04125|T041252e-90protein kinase PK12 (EC 2.7.1.-), ethylene-induced - common tobacco>gb:NTU73937_
JMSF040B03Sequence806011479 (6)pir|T04125|T041252e-71protein kinase PK12 (EC 2.7.1.-), ethylene-induced - common tobacco>gb:NTU73937_

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF008P14- GGTTTACCTACGGTTAGGGTTTCTCTCTCCTTTTTCTC
JMSF040A02- CGGTTAGGGTTTCTCTCTCCTTTTTCTC
                      ____________________________________________________________
consensus GGTTTACCTACGGTTAGGGTTTCTCTCTCCTTTTTCTC
 
. : . : . : . : . : . :
JMSF008P14- TCTCTATGTCGTGCTTTCTGTATCTAATCTCTGTGAATGATTAATCCATGGAAACAGATC
JMSF040A02- TCTCTATGTCGTGCTTTCTGTATCTAATCTCTGTGAATGATTAATCCATGGAAACAGATC
                      ____________________________________________________________
consensus TCTCTATGTCGTGCTTTCTGTATCTAATCTCTGTGAATGATTAATCCATGGAAACAGATC
 
. : . : . : . : . : . :
JMSF008P14- TCATGGCTGACTATCCTCAGGCTTACATGGATCGTCGCCCTAAGAAACGAGCCAGATTAG
JMSF040A02- TCATGGCTGACTATCCTCAGGCTTACATGGATCGTCGCCCTAAGAAACGAGCCAGATTAG
                      ____________________________________________________________
consensus TCATGGCTGACTATCCTCAGGCTTACATGGATCGTCGCCCTAAGAAACGAGCCAGATTAG
 
. : . : . : . : . : . :
JMSF008P14- ATTGGGACCCTTCTCATACTCCCAAGGCTCAGCCAGGGATATATTATGGGCAAGAGGTTG
JMSF040A02- ATTGGGACCCTTCTCATACTCCCAAGGCTCAGCCAGGGATATATTATGGGCAAGAGGTTG
                      ____________________________________________________________
consensus ATTGGGACCCTTCTCATACTCCCAAGGCTCAGCCAGGGATATATTATGGGCAAGAGGTTG
 
. : . : . : . : . : . :
JMSF008P14- GCACTGTGT
JMSF040A02- GCACTGTGTCAAGCTATGCACATGGAAGAGTACTTTCTCATCATGATAATGTATATGTAA
                      ____________________________________________________________
consensus GCACTGTGTCAAGCTATGCACATGGAAGAGTACTTTCTCATCATGATAATGTATATGTAA
 
. : . : . : . : . : . :
JMSF040A02- AGGGACTGGCTCAAAAAGGCTCTCCCCCATGGCGAGATGATGACAAAGATGGGCATTACA
                      ____________________________________________________________
consensus AGGGACTGGCTCAAAAAGGCTCTCCCCCATGGCGAGATGATGACAAAGATGGGCATTACA
 
. : . : . : . : . : . :
JMSF040A02- TATTTGAGCTGGGAGAAAATTTAACTACCCGCTATAAGATCCTTAGGAAGATTGGGGAAG
                      ____________________________________________________________
consensus TATTTGAGCTGGGAGAAAATTTAACTACCCGCTATAAGATCCTTAGGAAGATTGGGGAAG
 
. : . : . : . : . : . :
JMSF040A02- GTACCTTTGGTCGAGTTCTGGAATGCTGGGATAGGGATCAGAAGGAGTTGGTTGCTATAA
JMFS110E07- TACCTTTGGTCAAGTTCTGGAATGCTGGGATAGGGATCATAAGGAGTTGGTTGCTATAA
                      ____________________________________________________________
consensus GTACCTTTGGTCGAGTTCTGGAATGCTGGGATAGGGATCATAAGGAGTTGGTTGCTATAA
 
. : . : . : . : . : . :
JMSF040A02- AAATTGTCCGCAGCATTAAAAAGTATCGTGAGGCTGCAATGGTAGAAGTTGATGTGCTTC
JMFS110E07- AAATTGTCCGCAGCATTAAAAAGTATCGTGAGGCTGCAATGGTAGAAGTTGATGTGCTTC
                      ____________________________________________________________
consensus AAATTGTCCGCAGCATTAAAAAGTATCGTGAGGCTGCAATGGTAGAAGTTGATGTGCTTC
 
. : . : . : . : . : . :
JMSF040A02- AGTTGCTTGGAAGATATGACAGGAGTGGCAGTCGTTGTGTTCAATTACGGAACTGGTTTG
JMFS110E07- AGTTGCTTGGAAGATATGACAGGAGTGGCAGTCGATGTGTTCAATTACGGAACTGGTTTG
                      ____________________________________________________________
consensus AGTTGCTTGGAAGATATGACAGGAGTGGCAGTCGTTGTGTTCAATTACGGAACTGGTTTG
 
. : . : . : . : . : . :
JMSF040A02- ATTACCGTAACCATATATGTTTAGT
JMFS110E07- ATTACCGGAACCATATATGTTTAGTGTTTGAGAAGCTTGGACCAAGTTTATTCGATTGTC
                      ____________________________________________________________
consensus ATTACCGTAACCATATATGTTTAGTGTTTGAGAAGCTTGGACCAAGTTTATTCGATTGTC
 
. : . : . : . : . : . :
JMFS110E07- TACGGAAAAACAATTATCGCTCATTTCCAGCTGACCTAGTTCGCGAGATTGCCAGACAAC
                      ____________________________________________________________
consensus TACGGAAAAACAATTATCGCTCATTTCCAGCTGACCTAGTTCGCGAGATTGCCAGACAAC
 
. : . : . : . : . : . :
JMFS110E07- TGTTGGAATGTGTAGCATTCATGCATGATATGCGTCTAATCCACACTGATTTGAAGCCTG
                      ____________________________________________________________
consensus TGTTGGAATGTGTAGCATTCATGCATGATATGCGTCTAATCCACACTGATTTGAAGCCTG
 
. : . : . : . : . : . :
JMFS110E07- AGAATATACTCTTTGTATCTCCAGACTACATAAGAGTCCCTGACTACAAGTTTGCACCAT
                      ____________________________________________________________
consensus AGAATATACTCTTTGTATCTCCAGACTACATAAGAGTCCCTGACTACAAGTTTGCACCAT
 
. : . : . : . : . : . :
JMFS110E07- GGCCACCAATAGATGGATCATTCTATAAGAGGTTACCAAAATCAAGTGCTATCAAAGTGA
rJMSF040A02+ GGTTACCAAAATCAAGTGCTATCAAAGTGA
                      ____________________________________________________________
consensus GGCCACCAATAGATGGATCATTCTATAAGAGGTTACCAAAATCAAGTGCTATCAAAGTGA
 
. : . : . : . : . : . :
JMFS110E07- TTGATTTTGGTAGCACAGCTTATGAGCGTCAAGATCACAACTATATTGTCTCTACTAGAC
rJMSF040A02+ TTGATTTTGGTAGCACAGCTTATGAGCGTCAAGATCACAACTATATTGTCTCTACTAGAC
                      ____________________________________________________________
consensus TTGATTTTGGTAGCACAGCTTATGAGCGTCAAGATCACAACTATATTGTCTCTACTAGAC
 
. : . : . : . : . : . :
JMFS110E07- ATTACCGTGCACCTGAGGGTATCCTGGGTCTTGGATGGAGCTACCCATGTGATATGTGGA
rJMSF040B03+ ACCTGAGGTTATCCTGGGTCTTGGATGGAGCTACCCATGTGATATGTGGA
rJMSF040A02+ ATTACCGTGCACCTGAGGTTATCCTGGGTCTTGGATGGAGCTACCCATGTGATATGTGGA
                      ____________________________________________________________
consensus ATTACCGTGCACCTGAGGTTATCCTGGGTCTTGGATGGAGCTACCCATGTGATATGTGGA
 
. : . : . : . : . : . :
JMFS110E07- GTGTTGGATGTATATTGCTAGAACTGTGCTCGGGTGAAGCTTTGCTCCAAAC
rJMSF040B03+ GTGTTGGATGTATATTGGTAGAACTGTGCTCGGGTGAAGCTTTGTTCCAAACACATGAAA
rJMSF040A02+ GTGTTGGATGTATATTGGTAGAACTGTGCTCGGGTGAAGCTTTGTTCCAAACACATGAAA
rJMSF008P14+ CCAAACACATGAAA
                      ____________________________________________________________
consensus GTGTTGGATGTATATTGGTAGAACTGTGCTCGGGTGAAGCTTTGTTCCAAACACATGAAA
 
. : . : . : . : . : . :
rJMSF040B03+ ACTTAGAGCACCTTGCCATGATGGAGAGAGTTTTGGGTCCTTTGCCACTGCACATTTTGA
rJMSF040A02+ ACTTAGAGCACCTTGCCATGATGGAGAGAGTTTTGGGTCCTTTGCCACTGCACATTTTGA
rJMSF008P14+ ACNTAGAGCACCTTGCCATGATGGAGAGAGTTTTGGGTCCTTTGCCACTGCACATTTTGA
                      ____________________________________________________________
consensus ACTTAGAGCACCTTGCCATGATGGAGAGAGTTTTGGGTCCTTTGCCACTGCACATTTTGA
 
. : . : . : . : . : . :
rJMSF040B03+ AAAGAGCTGATCGACATGCTGAGAAATATGTGAAAAGGGGTAGACTTGACTGGCCAGAAG
rJMSF040A02+ AAAGAGCTGATCGACATGCTGAGAAATATGTGAAAAGGGGTAGACTTGACTGGCCAGAAG
rJMSF008P14+ AAAGAGCTGATCGACATGCTGAGAAATATGTGAAAAGGGGTAGACTTGACTGGCCAGAAG
                      ____________________________________________________________
consensus AAAGAGCTGATCGACATGCTGAGAAATATGTGAAAAGGGGTAGACTTGACTGGCCAGAAG
 
. : . : . : . : . : . :
rJMSF040B03+ GTGCAACATCAAGGAATAGCATTAAGTCTGTCATGAAATTACCTCGTCTTCAGAACTTGG
rJMSF040A02+ GTGCAACATCAAGGAATAGCATTAAGTCTGTCATGAAATTACCTCGTCTTCAGAACTTGG
rJMSF008P14+ GTGCAACATCAAGGAATAGCATTAAGTCTGTCATGAAATTACCTCGTCTTCAGAACTTGG
                      ____________________________________________________________
consensus GTGCAACATCAAGGAATAGCATTAAGTCTGTCATGAAATTACCTCGTCTTCAGAACTTGG
 
. : . : . : . : . : . :
rJMSF040B03+ TGATGCAGCATGTTGATCACTCAGCAGGTGATCTTATCGACCTCCTGCAAGGACTACTTA
rJMSF040A02+ TGATGCAGCATGTTGATCACTCAGCAGGTGATCTTATCGACCTCCTGCAAGGACTACTTA
rJMSF008P14+ TGATGCAGCATGTTGATCACTCAGCAGGTGATCTTATCGACCTCCTGCAAGGACTACTTA
                      ____________________________________________________________
consensus TGATGCAGCATGTTGATCACTCAGCAGGTGATCTTATCGACCTCCTGCAAGGACTACTTA
 
. : . : . : . : . : . :
rJMSF040B03+ GATATGACCCGTCTATAAGGATGACAGCTCGAAATGCACTCAAGCATCCGTTTTTCACTT
rJMSF040A02+ GATATGACCCGTCTATAAGGATGACAGCTCGAAATGCACTCAAGCATCCGTTTTTCACTT
rJMSF008P14+ GATATGACCCGTCTATAAGGATGACAGCTCGAAATGCACTCAAGCATCCGTTTTTCACTT
                      ____________________________________________________________
consensus GATATGACCCGTCTATAAGGATGACAGCTCGAAATGCACTCAAGCATCCGTTTTTCACTT
 
. : . : . : . : . : . :
rJMSF040B03+ GTGACCAATTAAGGAGGTCATAAGCGACAGCACTGTGGTGTGGATGATTTGTTGCCTAAC
rJMSF040A02+ GTGACCAATTAAGGAGGTCATAAGCGACAGCACTGTGGTGTGGATGATTTGTTGCCTAAC
rJMSF008P14+ GTGACCAATTAAGGAGGTCATAAGCGACAGCACTGTGGTGTGGATGATTTGTTGCCTAAC
                      ____________________________________________________________
consensus GTGACCAATTAAGGAGGTCATAAGCGACAGCACTGTGGTGTGGATGATTTGTTGCCTAAC
 
. : . : . : . : . : . :
rJMSF040B03+ ACAGATGCCCCATGGCACTTTGCGTGGATTGCTTAGAACGCCTAAACTCTTTGCCCAACA
rJMSF040A02+ ACAGATGCCCCATGGCACTTTGCGTGGATTGCTTAGAACGCCTAAACTCTTTGCCCAACA
rJMSF008P14+ ACAGATGCCCCATGGCACTTTGCGTGGATTGCTTAGAACGCCTAAACTCTTTGCCCAACA
                      ____________________________________________________________
consensus ACAGATGCCCCATGGCACTTTGCGTGGATTGCTTAGAACGCCTAAACTCTTTGCCCAACA
 
. : . : . : . : . : . :
rJMSF040B03+ CATTGTTTCTTGGAGCTCTTGTAAATAACGTCATCACGATTCACGAGATGCCCTTTCATT
rJMSF040A02+ CATTGTTTCTTGGAGCTCTTGTAAATAACGTCATCACGATTCACGAGATGCCCTTTCATT
rJMSF008P14+ CATTGTTTCTTGGAGCTCTTGTAAATAACGTCATCACGATTCACGAGATGCCCTTTCATT
                      ____________________________________________________________
consensus CATTGTTTCTTGGAGCTCTTGTAAATAACGTCATCACGATTCACGAGATGCCCTTTCATT
 
. : . : . : . : . : . :
rJMSF040B03+ CCGAGTTGTGATCTTGTGCTTCTGCTGCTGCCTGGCCCCCTGACCCTGGCAGCGTAAGTT
rJMSF040A02+ CCGAGTTGTGATCTTGTGCTTCTGCTGCTGCCTGGCCCCCTGACCCTGGCAGCGTAAGTT
rJMSF008P14+ CCGAGTTGTGATCTTGTGCTTCTGCTGCTGCCTGGCCCCCTGACCCTGGCAGCGTAAGTT
                      ____________________________________________________________
consensus CCGAGTTGTGATCTTGTGCTTCTGCTGCTGCCTGGCCCCCTGACCCTGGCAGCGTAAGTT
 
. : . : . : . : . : . :
rJMSF040B03+ TTGTAAGAGCTTTTCTCTTCCTGAAACTGGATCTTCTACTTGTTTACAAATGATGTACAA
rJMSF040A02+ TTGTAAGAGCTTTTCTCTTCCTGAAACTGGATCTTCTACTTGTTTACAAATGATGTACAA
rJMSF008P14+ TTGTAAGAGCTTTTCTCTTCCTGAAACTGGATCTTCTACTTGTTTACAAATGATGTACAA
                      ____________________________________________________________
consensus TTGTAAGAGCTTTTCTCTTCCTGAAACTGGATCTTCTACTTGTTTACAAATGATGTACAA
 
. : . : . : . : . : . :
rJMSF040B03+ TTTCAGTTTGTAAGTCTATTTGTTATGTTAATAATACATCATCTCCATTATTTTTTATTT
rJMSF040A02+ TTTCAGTTTGTAAGTCTATTTGTTATGTTAATAATACATCATCTCCATTATTTTTTATTT
rJMSF008P14+ TTTCAGTTTGTAAGTCTATTTGTTATGTTAATAATACATCATCTCCATTATTTTTTATTT
                      ____________________________________________________________
consensus TTTCAGTTTGTAAGTCTATTTGTTATGTTAATAATACATCATCTCCATTATTTTTTATTT
 
. : . : . : . : . : . :
rJMSF040B03+ TTTTTACTATTTGCATTTGTAAATTGTGCTTCGT
rJMSF040A02+ TTTTTACTATTTGCATTTGTAAATTGTGCTTCGT
rJMSF008P14+ TTTTTACTATTTGCATTNGTAAATTGTGCTTCGTNTTCTGAAGCTGATCAGTTGTCAATA
                      ____________________________________________________________
consensus TTTTTACTATTTGCATTTGTAAATTGTGCTTCGTNTTCTGAAGCTGATCAGTTGTCAATA