Previous Contig 011475:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008O16Sequence219005039 (3)648011475 (3)gb:AF202987_17765466e-82Petroselinum crispum acyl-CoA oxidase (ACO) gene, complete cds.
JMSF018E24Sequence461005039 (3)gb:AF202987_17765467e-32Petroselinum crispum acyl-CoA oxidase (ACO) gene, complete cds.634011475 (3)gb:AF202987_17765465e-82Petroselinum crispum acyl-CoA oxidase (ACO) gene, complete cds.
JMSF024N22Sequence659006250 (2)pir|T52120|T521203e-48acyl-CoA oxidase (EC 1.3.3.6), peroxisomal [validated] - Arabidopsis thaliana>gb803011475 (3)gb:AF202987_1776546e-103Petroselinum crispum acyl-CoA oxidase (ACO) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024N22+ TGAGGAATGACCATGACATATTTCAAACA
                      ____________________________________________________________
consensus TGAGGAATGACCATGACATATTTCAAACA
 
. : . : . : . : . : . :
rJMSF024N22+ TTGAAGGGGACAACACAGTCCTTCTACAGCAGGTAGCAGGATTTCTTTTGAAGCAGTATA
                      ____________________________________________________________
consensus TTGAAGGGGACAACACAGTCCTTCTACAGCAGGTAGCAGGATTTCTTTTGAAGCAGTATA
 
. : . : . : . : . : . :
rJMSF024N22+ GGGAGAAGTTCAAAGGTGGGACACTTGCAGTTACATGGAACTATTTAAGACAGTCGATGA
                      ____________________________________________________________
consensus GGGAGAAGTTCAAAGGTGGGACACTTGCAGTTACATGGAACTATTTAAGACAGTCGATGA
 
. : . : . : . : . : . :
rJMSF024N22+ ATTCTTATCTCTCTCAGCCTAACCCAGTAACTGCTAGGTGGGAAAGTGAAGACCATTTGC
rJMSF018E24+ CTCAGCCTAACCCAGTAACTTCTAGGTGGGAAGGTGAAGACCATTTGC
rJMSF008O16+ CTCAGCCTAACCCAGTAACTTCTAGGTGGGAAGGTGAAGACCATTTGC
                      ____________________________________________________________
consensus ATTCTTATCTCTCTCAGCCTAACCCAGTAACTTCTAGGTGGGAAGGTGAAGACCATTTGC
 
. : . : . : . : . : . :
rJMSF024N22+ GAGATCCAAACTTCCAGTTGGATGCTTTTAGGTATCGTACATCACGATTGCTTCAAGGTG
rJMSF018E24+ GAGATCCTAACTTCCAGTTAGATGCTTTTAGGTATCGCACATCTCGGTTACTTCAAAGTG
rJMSF008O16+ GAGATCCTAACTTCCAGTTAGATGCTTTTAGGTATCGCACATCTCGGTTACTTCAAAGTG
                      ____________________________________________________________
consensus GAGATCCTAACTTCCAGTTAGATGCTTTTAGGTATCGCACATCTCGGTTACTTCAAAGTG
 
. : . : . : . : . : . :
rJMSF024N22+ TCTCTGTTCGACTTCAGAAGCACTTGAAGACCCTGGGGGGCTTTGGTGCTTGGAATAGAT
rJMSF018E24+ TTGCTATTCGACTTCAGAAGCACTCAAAGAATCTTGGGGGCTTTGGTGCTTGGAATAGAT
rJMSF008O16+ TTGCTATTCGACTTCAGAAGCACTCAAAGAATCTTGGGGGCTTTGGTGCTTGGAATAGAT
                      ____________________________________________________________
consensus TTGCTATTCGACTTCAGAAGCACTCAAAGAATCTTGGGGGCTTTGGTGCTTGGAATAGAT
 
. : . : . : . : . : . :
rJMSF024N22+ GCTTAAATCATCTGTTGACGCTCGCAGAGTCCCACATTGAGTCCTTCATCCTTGAAAACT
rJMSF018E24+ GCTTAAATCACCTCTTGACACTTGCAGAGTCCCACATTGAGTCCTTCATCCTTGAAATTT
rJMSF008O16+ GCTTAAATCACCTCTTGACACTTGCAGAGTCCCACATTGAGTCCTTCATCCTTGAAATTT
                      ____________________________________________________________
consensus GCTTAAATCACCTCTTGACACTTGCAGAGTCCCACATTGAGTCCTTCATCCTTGAAATTT
 
. : . : . : . : . : . :
rJMSF024N22+ TCATTGAAGCCATAAAACGTTGTCCTAATGCCAACTCTCGTGCTGCCCTGAAACTCGTCT
rJMSF018E24+ TTATTCAAGCTGTCAAAAGTTGTCCCGATCCCAGTTCTCGTGCTGCTCTGAAACTTGTCT
rJMSF008O16+ TTATTCAAGCTGTCAAAAGTTGTCCCGATCCCAGTTCTCGTGCTGCTCTGAAACTTGTCT
                      ____________________________________________________________
consensus TTATTCAAGCTGTCAAAAGTTGTCCCGATCCCAGTTCTCGTGCTGCTCTGAAACTTGTCT
 
. : . : . : . : . : . :
rJMSF024N22+ GCGACCTTTATGCCTTGGATCGAATCTGGAATGACATAGGAACTTATCGCAATGTGGATT
rJMSF018E24+ GCGACCTTTATGCTTTGAATCGAATCTGGAATGATATAGGAACTTACCGCAATGTAGACT
rJMSF008O16+ GCGACCTTTATGCTTTGAATCGAATCTGGAATGATATAGGAACTTACCGCAATGTAGACT
                      ____________________________________________________________
consensus GCGACCTTTATGCTTTGAATCGAATCTGGAATGATATAGGAACTTACCGCAATGTAGACT
 
. : . : . : . : . : . :
rJMSF024N22+ ACCTGGCTCCTAACAAAGCTAAGGCAGTTCAAAAGTTGATGGAATATCTGTGTTTCCAAG
rJMSF018E24+ ATGTGGCTCCTAACAAAGCTAAGGCAATTAACAAGTTAACTGAATATCTGTGCTTCCAAG
rJMSF008O16+ ATGTGGCTCCTAACAAAGCTAAGGCAATTAACAAGTTAACTGAATATCTGTGCTTCCAAG
                      ____________________________________________________________
consensus ATGTGGCTCCTAACAAAGCTAAGGCAATTAACAAGTTAACTGAATATCTGTGCTTCCAAG
 
. : . : . : . : . : . :
rJMSF024N22+ TTAGGAATATCGCAAAGGAGCTCATAGATGGCTTTGATATACCCGAGTATGTTATACGCG
rJMSF018E24+ TCAGAAATACAGCAAAGGACCTCGTTGATGCCTTTGACCTACCAGATTATGTTATACGGG
rJMSF008O16+ TCAGAAATACAGCAAAGGACCTCGTTGATGCCTTTGACCTACCAGATTATGTTATACGGG
                      ____________________________________________________________
consensus TCAGAAATACAGCAAAGGACCTCGTTGATGCCTTTGACCTACCAGATTATGTTATACGGG
 
. : . : . : . : . : . :
rJMSF024N22+ CTCCAATCGCTTTGCAGGAT
rJMSF018E24+ CTCCAATTGCTTTGCAGGAT
rJMSF008O16+ CTCCAATTGCTTTGCAGGATTCGGAACAAGTTTACTTACAATACGCTCAATATGCCGGAT
                      ____________________________________________________________
consensus CTCCAATTGCTTTGCAGGATTCGGAACAAGTTTACTTACAATACGCTCAATATGCCGGAT
 
. : . : . : . : . : . :
rJMSF008O16+ TCTAGTTCCTGCACAAGGCAATAAACAACTTCATCTTCAGATAGGATAGTTTCAAATATA
                      ____________________________________________________________
consensus TCTAGTTCCTGCACAAGGCAATAAACAACTTCATCTTCAGATAGGATAGTTTCAAATATA
 
. : . : . : . : . : . :
rJMSF008O16+ CAACAGAAAATAAAAAGGGGGATGGGTCTGGGATCATCATTGATTTGAATCTACAACTAT
                      ____________________________________________________________
consensus CAACAGAAAATAAAAAGGGGGATGGGTCTGGGATCATCATTGATTTGAATCTACAACTAT