Previous Contig 011474:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008O13Sequence234018595gb:BT006164_16390574e-18Arabidopsis thaliana clone RAFL19-58-K08 (R50778) unknown protein (At3g11960) mR773011474 (2)gb:BT006164_16390572e-53Arabidopsis thaliana clone RAFL19-58-K08 (R50778) unknown protein (At3g11960) mR
JMSF019B05Sequence273019102gb:BT006164_16390577e-12Arabidopsis thaliana clone RAFL19-58-K08 (R50778) unknown protein (At3g11960) mR799011474 (2)gb:BT006164_16390577e-62Arabidopsis thaliana clone RAFL19-58-K08 (R50778) unknown protein (At3g11960) mR

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019B05+ ATCGGGAGGATTCAAGAAAACTGGAACAGCTTTACTGTGA
                      ____________________________________________________________
consensus ATCGGGAGGATTCAAGAAAACTGGAACAGCTTTACTGTGA
 
. : . : . : . : . : . :
rJMSF019B05+ TCCTGTCCAGCGGTTAGTTGCTGATTGTATTCTTATGGATGCTGATACAGCTGCAGTTTC
rJMSF008O13+ CCAGCGGTTAGNTGCTGATTGTATTCTTATGGATGCTGATACAGCTGCAGTTTC
                      ____________________________________________________________
consensus TCCTGTCCAGCGGTTAGTTGCTGATTGTATTCTTATGGATGCTGATACAGCTGCAGTTTC
 
. : . : . : . : . : . :
rJMSF019B05+ TGATCGAAAGGGGAGTGTTGCCATCTTGTCCTGTTTAAATCATTCAGAAGAGAATTCCAG
rJMSF008O13+ TGATCGAAAGGGGAGTGTTGCCATCTTGTCCTGTTTAAATCATTCAGAAGAGAATTCCAG
                      ____________________________________________________________
consensus TGATCGAAAGGGGAGTGTTGCCATCTTGTCCTGTTTAAATCATTCAGAAGAGAATTCCAG
 
. : . : . : . : . : . :
rJMSF019B05+ TCCTGAAAGCAACTTAGCTGTAGTTTCATCATTTTACATGGGTGAAATTGCGATGCGGAT
rJMSF008O13+ TCCTGAAAGCAACTTAGCTGTAGTTTCATCATTTTACATGGGTGAAATTGCGATGCGGAT
                      ____________________________________________________________
consensus TCCTGAAAGCAACTTAGCTGTAGTTTCATCATTTTACATGGGTGAAATTGCGATGCGGAT
 
. : . : . : . : . : . :
rJMSF019B05+ CCGAAAAGGCTCATTCTCCTACAAACTTCCTGCTGACGATGTTTTGAGGGGCTGTCGAGA
rJMSF008O13+ CCGAAAAGGCTCATTCTCCTACAAACTTCCTGCTGACGATGTTTTGAGGGGCTGTCGAGA
                      ____________________________________________________________
consensus CCGAAAAGGCTCATTCTCCTACAAACTTCCTGCTGACGATGTTTTGAGGGGCTGTCGAGA
 
. : . : . : . : . : . :
rJMSF019B05+ CACTAATGGCGTTAGTGATGTGTCACAGAGTAGCATTATGGCTAGCACACTGTTAGGAAG
rJMSF008O13+ CACTAATGGCGTTAGTGATGTGTCACAGAGTAGCATTATGGCTAGCACACTGTTAGTAAG
                      ____________________________________________________________
consensus CACTAATGGCGTTAGTGATGTGTCACAGAGTAGCATTATGGCTAGCACACTGTTAGTAAG
 
. : . : . : . : . : . :
rJMSF019B05+ CATAATTACTTTTGTTCCTCTGACAAGGGTGGAATATGAACTGTTAGAAGCAGTACAAGC
rJMSF008O13+ CATAATTACTTTTGTTCCTCTGACAAGGGTGGAATATGAACTGTTAGAAGCAGTACAAGC
                      ____________________________________________________________
consensus CATAATTACTTTTGTTCCTCTGACAAGGGTGGAATATGAACTGTTAGAAGCAGTACAAGC
 
. : . : . : . : . : . :
rJMSF019B05+ AAGGCTTGTTATTCATCCATTGACTGCTCCTATACTCGGAAATGACCATAATGAGTTCCG
rJMSF008O13+ AAGGCTTGTTATTCATCCATTGACTGCTCCTATACTCGGAAATGACCATAATGAGTTCCG
                      ____________________________________________________________
consensus AAGGCTTGTTATTCATCCATTGACTGCTCCTATACTCGGAAATGACCATAATGAGTTCCG
 
. : . : . : . : . : . :
rJMSF019B05+ CAGCCGTGAAAGTTCGGCTGGGGCACTGAGGGTACTTGATGGTGATATGCTTGCTCAGTT
rJMSF008O13+ CAGCCGTGAAAGTTCGGCTGGGGCACTGAGGGTACTTGATGGTGATATGCTTGCTCAGTT
                      ____________________________________________________________
consensus CAGCCGTGAAAGTTCGGCTGGGGCACTGAGGGTACTTGATGGTGATATGCTTGCTCAGTT
 
. : . : . : . : . : . :
rJMSF019B05+ CTTGGAGCTGACTAGTATGCAACAAGAGGCTGTATTAGCGCTACCCCTTGGCTCACATAA
rJMSF008O13+ CTTGGAGCTGACTAGTATGCAACAAGAGGCTGTATTAGCGCTACCCCTTGGCTCACATAA
                      ____________________________________________________________
consensus CTTGGAGCTGACTAGTATGCAACAAGAGGCTGTATTAGCGCTACCCCTTGGCTCACATAA
 
. : . : . : . : . : . :
rJMSF019B05+ TACAATCATGTTAAATTCAAAGCCCTTGCCTGCTCCTATTACTGTTAGTCAGGTTGTGCG
rJMSF008O13+ TACAATCATGTTAAATTCAAAGCCCTTGCCTGCTCCTATTACTGTTAGTCAGGTTGTGCG
                      ____________________________________________________________
consensus TACAATCATGTTAAATTCAAAGCCCTTGCCTGCTCCTATTACTGTTAGTCAGGTTGTGCG
 
. : . : . : . : . : . :
rJMSF019B05+ TCTGCTGGAGCGGGTTCACTATGCACTGAATTGAGTAAAATCATTTTGTAAGAATACAAC
rJMSF008O13+ TCTGCTGGAGCGGGTTCACTATGCACTGAATTGAGTAAAATCATTTTGTAAGAATACAAC
                      ____________________________________________________________
consensus TCTGCTGGAGCGGGTTCACTATGCACTGAATTGAGTAAAATCATTTTGTAAGAATACAAC
 
. : . : . : . : . : . :
rJMSF019B05+ CCCCGGCCTGTTCTATTTAGTTATACGATCTTCCAATCGAACCTGGGGTTTGCTCATTAT
rJMSF008O13+ CCCCGGCCTGTTCTATTTAGTTATACGATCTTCCAATCG-ACCTGGGGTTTGCTCATTAT
                      ____________________________________________________________
consensus CCCCGGCCTGTTCTATTTAGTTATACGATCTTCCAATCGAACCTGGGGTTTGCTCATTAT
 
. : . : . : . : . : . :
rJMSF019B05+ GCCTTTTGTGTCATGTCAATATAAGTCCGAAAC
rJMSF008O13+ GCCTTTTGTGTCATGTCAATATAAGTCCGAAACCTTGTGCACATTTTTGTTACAGGTGTT
                      ____________________________________________________________
consensus GCCTTTTGTGTCATGTCAATATAAGTCCGAAACCTTGTGCACATTTTTGTTACAGGTGTT