Previous Contig 011473:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012I06Sequence541000658 (2)741011473 (2)gb:AP005295_18500467e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ16
JMSF008O02Sequence323000658 (2)753011473 (2)gb:AP005295_18500469e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ16

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF012I06+ GAGGCAT
                      ____________________________________________________________
consensus GAGGCAT
 
. : . : . : . : . : . :
rJMFF012I06+ AATGATTCCCCANCAATTGCTTTTGCCACTGGAAATGCTGATGATCTAGGGTCTCATGAC
rJMSF008O02+ ACTGGAAATGCTGATGATCTAGGGTCTCATGAC
                      ____________________________________________________________
consensus AATGATTCCCCANCAATTGCTTTTGCCACTGGAAATGCTGATGATCTAGGGTCTCATGAC
 
. : . : . : . : . : . :
rJMFF012I06+ AGATGGCTTATTGATTTGAATGGTGATCTCCACTATGATGGAGTTGGATATGGTTCCAGT
rJMSF008O02+ AGATGGCTTATTGATTTGAATGGTGATCTCCACTATGATGGAGTTGGATATGGTTCCAGT
                      ____________________________________________________________
consensus AGATGGCTTATTGATTTGAATGGTGATCTCCACTATGATGGAGTTGGATATGGTTCCAGT
 
. : . : . : . : . : . :
rJMFF012I06+ TACTTAGGAGAAACAGGTCATCACAGAAACGAACGACGATTGCCATCAAGATCAGAGATC
rJMSF008O02+ TACTTAGGAGAAACAGGTCATCACAGAAACGAACGACGATTGCCATCAAGATCAGAGATC
                      ____________________________________________________________
consensus TACTTAGGAGAAACAGGTCATCACAGAAACGAACGACGATTGCCATCAAGATCAGAGATC
 
. : . : . : . : . : . :
rJMFF012I06+ TCTGAAAGAGTTCACAGAGGCCACAGAAATCGGGTTTCACAACCATCATTTTGCCCATCC
rJMSF008O02+ TCTGAAAGAGTTCACAGAGGCCACAGAAATCGGGTTTCACAACCATCATTTTGCCCATCC
                      ____________________________________________________________
consensus TCTGAAAGAGTTCACAGAGGCCACAGAAATCGGGTTTCACAACCATCATTTTGCCCATCC
 
. : . : . : . : . : . :
rJMFF012I06+ GGGCTCCACCCTGATGGTACATGCTCGTGCGAGTCATTCTTCACATCTGAAGAGTTCAGT
rJMSF008O02+ GGGCTCCACCCTGATGGTACATGCTCGTGCGAGTCATTCTTCACATCTGAAGAGTTCAGT
                      ____________________________________________________________
consensus GGGCTCCACCCTGATGGTACATGCTCGTGCGAGTCATTCTTCACATCTGAAGAGTTCAGT
 
. : . : . : . : . : . :
rJMFF012I06+ ACCCTTGCAAGTATTTCACGAATAATCATGCTTGCCGAGGCCTTATTTGAGGTAATCGAC
rJMSF008O02+ ACCCTTGCAAGTATTTCACGAATAATCATGCTTGCCGAGGCCTTATTTGAGGTAATCGAC
                      ____________________________________________________________
consensus ACCCTTGCAAGTATTTCACGAATAATCATGCTTGCCGAGGCCTTATTTGAGGTAATCGAC
 
. : . : . : . : . : . :
rJMFF012I06+ GAGATTCATAGACAATCTTTCTCACTATCAACGTTCTCGCTCCCAGCTCCAGAAGCTACA
rJMSF008O02+ GAGATTCATAGACAATCTTTCTCACTATCAACGTTCTCGCTCCCAGCTCCAGAAGCTACA
                      ____________________________________________________________
consensus GAGATTCATAGACAATCTTTCTCACTATCAACGTTCTCGCTCCCAGCTCCAGAAGCTACA
 
. : . : . : . : . : . :
rJMFF012I06+ GTAGATGCATTTCCTCTCAAATACCACAAAACTTTAGATCCCGTTGAAAATGCGTTGGGT
rJMSF008O02+ GTAGATGCATTTCCTCTCAAATACCACAAAACTTTAGATCCCGTTGAAAATGCGTTGGGT
                      ____________________________________________________________
consensus GTAGATGCATTTCCTCTCAAATACCACAAAACTTTAGATCCCGTTGAAAATGCGTTGGGT
 
. : . : . : . : . : . :
rJMFF012I06+ GATACACAGCAGTGCTATATCTGTTTGGCTGAGTATGAAGATGGCGACAAACTGAGGGTT
rJMSF008O02+ GATACACAGCAGTGCTATATCTGTTTGGCTGAGTATGAAGATGGCGACAAACTGAGGGTT
                      ____________________________________________________________
consensus GATACACAGCAGTGCTATATCTGTTTGGCTGAGTATGAAGATGGCGACAAACTGAGGGTT
 
. : . : . : . : . : . :
rJMFF012I06+ CTCCCTTGTCATCATGAATATCACATGATATGTATTGATAAATGGCTGAAAGAAGTAAAC
rJMSF008O02+ CTCCCTTGTCATCATGAATATCACATGATATGTATTGATAAATGGCTGAAAGAAGTAAAC
                      ____________________________________________________________
consensus CTCCCTTGTCATCATGAATATCACATGATATGTATTGATAAATGGCTGAAAGAAGTAAAC
 
. : . : . : . : . : . :
rJMFF012I06+ AGGGTATGCCCGGTTTGCAGATGCAACGTTTGTAATGGTCCCGGGCAAAGTTCCATCTCA
rJMSF008O02+ AGGGTATGCCCGGTTTGCAGATGCAACGTTTGTAATGGTCCCGGGCAAAGTTCCATCTCA
                      ____________________________________________________________
consensus AGGGTATGCCCGGTTTGCAGATGCAACGTTTGTAATGGTCCCGGGCAAAGTTCCATCTCA
 
. : . : . : . : . : . :
rJMFF012I06+ ACCACAGAAACCCCTTTGCAATGATGCAAAATTGTGAATATTCTATGCATACAATACATA
rJMSF008O02+ ACCACAGAAACCCCTTTGCAATGATGCAAAATTGTGAATATTCTATGCATACAATACATA
                      ____________________________________________________________
consensus ACCACAGAAACCCCTTTGCAATGATGCAAAATTGTGAATATTCTATGCATACAATACATA
 
. : . : . : . : . : . :
rJMFF012I06+ CAGACACACACATA
rJMSF008O02+ CAGACACACACATATACATATATGCATTTTCTGCAGTTGCCATCTAGCTCTGAACTTCTT
                      ____________________________________________________________
consensus CAGACACACACATATACATATATGCATTTTCTGCAGTTGCCATCTAGCTCTGAACTTCTT