Previous Contig 011472:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008O01Sequence296005896 (2)gb:AE016959_10231570.014Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08772011472 (2)gb:AB025631_15165534e-32Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPN9.
JMSF020G22Sequence537005896 (2)gb:AE016959_10231573e-17Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08747011472 (2)gb:AB025631_15165531e-30Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPN9.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020G22+ GGACTGAGCTGG
                      ____________________________________________________________
consensus GGACTGAGCTGG
 
. : . : . : . : . : . :
rJMSF020G22+ AGAGGAAGAATTGGACCAGAACTTACAAAAAGATGCTCCTCTCCTGAAAAATTTATACCA
rJMSF008O01+ GAATTGGACCAGAACTTACAAAAAGATGCTCCTCTCCTGAAAAATTTATACCA
                      ____________________________________________________________
consensus AGAGGAAGAATTGGACCAGAACTTACAAAAAGATGCTCCTCTCCTGAAAAATTTATACCA
 
. : . : . : . : . : . :
rJMSF020G22+ CGAAGTTTTACTTAAAGATAGGAATGCCAAATTCAGGGGCTAAGCACAGACAAATAGTAA
rJMSF008O01+ CGAAGTTTTACTTAAAGATA-GAATGCCAAATTCAGGGGCTAAGCACAGACAAATAGTAA
                      ____________________________________________________________
consensus CGAAGTTTTACTTAAAGATAGGAATGCCAAATTCAGGGGCTAAGCACAGACAAATAGTAA
 
. : . : . : . : . : . :
rJMSF020G22+ GTTCTCTGAATGGTTTGCATCAAACGCCCCTTCAAGTGGTGGTTGGTTCCATGCTAATTG
rJMSF008O01+ GTTCTCTGAATGGTTTGCATCAAACGCCCCTTCAAGTGGTGGTTGGTTCCATGCTAATTG
                      ____________________________________________________________
consensus GTTCTCTGAATGGTTTGCATCAAACGCCCCTTCAAGTGGTGGTTGGTTCCATGCTAATTG
 
. : . : . : . : . : . :
rJMSF020G22+ CAACAGACATGCTTCTGAATTCTCATCCATTTGGTGAATCCATAATTCTCATTGTGAAAG
rJMSF008O01+ CAACAGACATGCTTCTGAATTCTCATCCATTTGGTGAATCCATAATTCTCATTGTGAAAG
                      ____________________________________________________________
consensus CAACAGACATGCTTCTGAATTCTCATCCATTTGGTGAATCCATAATTCTCATTGTGAAAG
 
. : . : . : . : . : . :
rJMSF020G22+ GAAATCAGAGCTTAGGATTTCAAGGTCTAATTGTGAATAAGCGGATCAACTGGGAGTCTA
rJMSF008O01+ GAAATCAGAGCTTAGGATTTCAAGGTCTAATTGTGAATAAGCGGATCAACTGGGAGTCTA
                      ____________________________________________________________
consensus GAAATCAGAGCTTAGGATTTCAAGGTCTAATTGTGAATAAGCGGATCAACTGGGAGTCTA
 
. : . : . : . : . : . :
rJMSF020G22+ TAGATGAAGTCGAGGAAGGTTTAGAATTTCTTAAGGCAACTCCTCTATCTTTTGGTGGTC
rJMSF008O01+ TAGATGAAGTCGAGGAAGGTTTAGAATTTCTTAAGGCAACTCCTCTATCTTTTGGTGGTC
                      ____________________________________________________________
consensus TAGATGAAGTCGAGGAAGGTTTAGAATTTCTTAAGGCAACTCCTCTATCTTTTGGTGGTC
 
. : . : . : . : . : . :
rJMSF020G22+ CTGTACTCAAACGCGGAATGCCTCTTGTGGCTTTGTCAAAAAGAATTATTGAAGATCATA
rJMSF008O01+ CTGTACTCAAACGCGGAATGCCTCTTGTGGCTTTGTCAAAAAGAATTATTGAAGATCATA
                      ____________________________________________________________
consensus CTGTACTCAAACGCGGAATGCCTCTTGTGGCTTTGTCAAAAAGAATTATTGAAGATCATA
 
. : . : . : . : . : . :
rJMSF020G22+ ATCCGGAAGTCCTTCCAAACATCTACTTTCTTGATCAAGAAGCTACACTCCGTTTACTAG
rJMSF008O01+ ATCCGGAAGTCCTTCCAAACATCTACTTTCTTGATCAAGAAGCTACACTCCGTTTACTAG
                      ____________________________________________________________
consensus ATCCGGAAGTCCTTCCAAACATCTACTTTCTTGATCAAGAAGCTACACTCCGTTTACTAG
 
. : . : . : . : . : . :
rJMSF020G22+ ATGAAGCGAAAGCGGGAAACCAATCTGTCCATGATGTTTGGTTCTTCTTGGGATTTTCAA
rJMSF008O01+ ATGAAGCGAAAGCGGGAAACCAATCTGTCCATGATGTTTGGTTCTTCTTGGGATTTTCAA
                      ____________________________________________________________
consensus ATGAAGCGAAAGCGGGAAACCAATCTGTCCATGATGTTTGGTTCTTCTTGGGATTTTCAA
 
. : . : . : . : . : . :
rJMSF020G22+ GATGGGATGGGGACCAACTAGTTAACGAGATTATTGAAGGAGCTTGGACTCTGAGCAAAG
rJMSF008O01+ GATGGGATGGGGACCAACTAGTTAACGAGATTATTGAAGGAGCTTGGACTCTGAGCAAAG
                      ____________________________________________________________
consensus GATGGGATGGGGACCAACTAGTTAACGAGATTATTGAAGGAGCTTGGACTCTGAGCAAAG
 
. : . : . : . : . : . :
rJMSF020G22+ GTACCGAGGAGAAACTAGGTTGGCCTCTAATGTAAACTAAACCATCAAAAGTAGGGTGAT
rJMSF008O01+ GTACCGAGGAGAAACTAGGTTGGCCTCTAATGTAAACTAAACCATCAAAAGTAGGGTGAT
                      ____________________________________________________________
consensus GTACCGAGGAGAAACTAGGTTGGCCTCTAATGTAAACTAAACCATCAAAAGTAGGGTGAT
 
. : . : . : . : . : . :
rJMSF020G22+ CAAAGATTCAAGACCCATGTAGGATTAGCATAGCCTNCAGTATAACCACTTGTATCACAG
rJMSF008O01+ CAAAGATTCAAGACCCATGTAGGATTAGCATAGCCTACAGTATAACCACTTGTATCACAG
                      ____________________________________________________________
consensus CAAAGATTCAAGACCCATGTAGGATTAGCATAGCCTACAGTATAACCACTTGTATCACAG
 
. : . : . : . : . : . :
rJMSF020G22+ CTGTACATAAGATTT
rJMSF008O01+ CTGTACATAAGATTTTTTTTCTCTCTCACATGATTAAGTGATAACAGCATGTATGATGCT
                      ____________________________________________________________
consensus CTGTACATAAGATTTTTTTTCTCTCTCACATGATTAAGTGATAACAGCATGTATGATGCT