Previous Contig 011465:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008M15Sequence244011465 (2)719011465 (2)gb:AP005852_18591212e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P041

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF008M15- GACGGATCTAAGCTCTTCTCTATCTCTA
                      ____________________________________________________________
consensus GACGGATCTAAGCTCTTCTCTATCTCTA
 
. : . : . : . : . : . :
JMSF008M15- AGCTCTGGCGATTGACGACGGCGGCAAGTTGGACTCCTCTCTCACATCGACAAAGGCGGC
rJMSF008M15+ GCTCTGGCGATNGACGACGGCGGCAAGTTGGACTCCTCTCTCACATCGACAAAGGCGGC
                      ____________________________________________________________
consensus AGCTCTGGCGATTGACGACGGCGGCAAGTTGGACTCCTCTCTCACATCGACAAAGGCGGC
 
. : . : . : . : . : . :
JMSF008M15- AAGTTGGACTCCTCTCTCACATCGACGAAGGCGGGTATCTCCAGACTCCAGCGATCGATG
rJMSF008M15+ AAGTTGGACTCCTCTCTCACATCGACGAAGGCGGGTATCTCCAGACTCCAGCGATCGATG
                      ____________________________________________________________
consensus AAGTTGGACTCCTCTCTCACATCGACGAAGGCGGGTATCTCCAGACTCCAGCGATCGATG
 
. : . : . : . : . : . :
JMSF008M15- ACGATGACGGCTTGAAATCCTCTCTCTATAGTCTACGAAAGTGGCATCAGCAGCGGCAGT
rJMSF008M15+ ACGATGACGGCTTGAAATCCTCTCTCTATAGTCTACGAAAGTGGCATCAGCAGCGGCAGT
                      ____________________________________________________________
consensus ACGATGACGGCTTGAAATCCTCTCTCTATAGTCTACGAAAGTGGCATCAGCAGCGGCAGT
 
. : . : . : . : . : . :
JMSF008M15- GTTTGATGGAAATATTGGCGGCGTGAGCAGCGGCGA
rJMSF008M15+ GTTTGATGGAAATATTGGCGGCGTGAGCAGCGGCGACGGCACCAGCTCCGGCGTTGCTAC
                      ____________________________________________________________
consensus GTTTGATGGAAATATTGGCGGCGTGAGCAGCGGCGACGGCACCAGCTCCGGCGTTGCTAC
 
. : . : . : . : . : . :
rJMSF008M15+ GCTTCCTCAGGTACGTGCGGTTGCTGTCTTTCATTTATTTAACTACTCAAATTGTAATTT
                      ____________________________________________________________
consensus GCTTCCTCAGGTACGTGCGGTTGCTGTCTTTCATTTATTTAACTACTCAAATTGTAATTT
 
. : . : . : . : . : . :
rJMSF008M15+ CAGTTTTAAATTTAAAGTTTATATATGTCAATGCCGTTCGAAATATGGTCGACCGCTCGC
                      ____________________________________________________________
consensus CAGTTTTAAATTTAAAGTTTATATATGTCAATGCCGTTCGAAATATGGTCGACCGCTCGC
 
. : . : . : . : . : . :
rJMSF008M15+ TGTCACCTCAACCGCTGCCAGTCACCGTCGCCACCATCTTCCACCTACATTATGGTCGTC
                      ____________________________________________________________
consensus TGTCACCTCAACCGCTGCCAGTCACCGTCGCCACCATCTTCCACCTACATTATGGTCGTC
 
. : . : . : . : . : . :
rJMSF008M15+ GGAATGGAAGGCTAGAACGGCGTCTCCGATTGCTATGATGAGATTAGGGTTTAGAATACA
                      ____________________________________________________________
consensus GGAATGGAAGGCTAGAACGGCGTCTCCGATTGCTATGATGAGATTAGGGTTTAGAATACA
 
. : . : . : . : . : . :
rJMSF008M15+ GTGATGTTGATGACTATATTGCAAATTTTGAGCCTCTTATGTTTGAAGAAGTTAAAGCTC
                      ____________________________________________________________
consensus GTGATGTTGATGACTATATTGCAAATTTTGAGCCTCTTATGTTTGAAGAAGTTAAAGCTC
 
. : . : . : . : . : . :
rJMSF008M15+ AGATTATTCAAGGGAAGAAGGATGATGAGGGAGGTAACTTTTTTAGGTTTGCTTTCTCTG
                      ____________________________________________________________
consensus AGATTATTCAAGGGAAGAAGGATGATGAGGGAGGTAACTTTTTTAGGTTTGCTTTCTCTG
 
. : . : . : . : . : . :
rJMSF008M15+ TTTCCTTGTTAGTGGAGCTGATTTTGAGATTGGTGATTATAGGTGTGAGAGGTAGAGAGG
                      ____________________________________________________________
consensus TTTCCTTGTTAGTGGAGCTGATTTTGAGATTGGTGATTATAGGTGTGAGAGGTAGAGAGG
 
. : . : . : . : . : . :
rJMSF008M15+ AAATAGACCAAATTGTTGTTTAAATTGCTAGTTTTGACTTTGCCTATTGGGCTAAGAATG
                      ____________________________________________________________
consensus AAATAGACCAAATTGTTGTTTAAATTGCTAGTTTTGACTTTGCCTATTGGGCTAAGAATG