Previous Contig 011459:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN042K18Sequence627011459 (4)gb:AP003864_18344962e-59Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10
JMSF008K23Sequence336011459 (4)sp|Q41000|ATP4_PEA5e-09ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|T06549|T06728011459 (4)sp|Q40089|ATP4_IPOBA1e-72ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41
JMSF026J08Sequence713019433gb:AB010069_15108518e-41Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAC9.740011459 (4)sp|Q40089|ATP4_IPOBA1e-74ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF008K23- GAAGAATGCGATAGCGCAAAAACGAAA
JMFN042K18- CGAAA
                      ____________________________________________________________
consensus GAAGAATGCGATAGCGCAAAAACGAAA
 
. : . : . : . : . : . :
JMSF008K23- CCTTTATGGCGAGAGAGAAATAGAGAAACCCGTATCCGGCGAACGCCTCTTATGATTGCC
JMFN042K18- CCTTTATGGCGAGAGAGAAATAGAGAAACCCGTATCCGGCGAACGCCTCTTATGATTGCC
                      ____________________________________________________________
consensus CCTTTATGGCGAGAGAGAAATAGAGAAACCCGTATCCGGCGAACGCCTCTTATGATTGCC
 
. : . : . : . : . : . :
JMSF008K23- TGAGACAGCAGCCTATTTGCTTTCCCATTTCTCCGACTTGCGAGCCGAGCGATCTCCGAT
JMFN042K18- TGAGACAGCAGCCTATTTGCTTTCCCATTTCTCCGACTTGCGAGCCGAGCGATCTCCGAT
                      ____________________________________________________________
consensus TGAGACAGCAGCCTATTTGCTTTCCCATTTCTCCGACTTGCGAGCCGAGCGATCTCCGAT
 
. : . : . : . : . : . :
JMSF008K23- TTTGGTGCCACCATGTTCCGTTACGCCGCCACTCGCTTGTTGAACCGATCGGCATCCCCC
JMFN042K18- TTTGGTGCCACCATGTTCCGTTACGCCGCCACTCGCTTGTTGAACCGATCGGCATCCCCC
                      ____________________________________________________________
consensus TTTGGTGCCACCATGTTCCGTTACGCCGCCACTCGCTTGTTGAACCGATCGGCATCCCCC
 
. : . : . : . : . : . :
JMSF008K23- GTCGCCGGAGGATCGCGACGATTCTCCACTGATCTCGCCTCCGCGCCGTCCGCCGATGAG
JMFN042K18- GTCGCCGGAGGATCGCGACGATTCTCCACTGATCTCGCCTCCGCGCCGTCCGCCGATGAG
rJMSF026J08+ TCCGCGCCGTCCGCCGATGAG
rJMSF008K23+ CCGATGAG
                      ____________________________________________________________
consensus GTCGCCGGAGGATCGCGACGATTCTCCACTGATCTCGCCTCCGCGCCGTCCGCCGATGAG
 
. : . : . : . : . : . :
JMSF008K23- GCCTTCGTGTCCGCCTGGAGGAGGACGGTTCCTAACATTGACCCACCCAAGACCCCTCTC
JMFN042K18- GCCTTCGTGTCCGCCTGGAGGAGGACGGTTCCTAACATTGACCCACCCAAGACCCCTCTC
rJMSF026J08+ GCCTTCGTGTCCGCCTGGAGGAGGACGGTTCCTAACATTGACCCACCCAAGACCCCTCTC
rJMSF008K23+ GCCTTCGTGTCCGCCTGGAGGAGGACGGTTCCTAACATTGACCCACCCAAGACCCCTCTC
                      ____________________________________________________________
consensus GCCTTCGTGTCCGCCTGGAGGAGGACGGTTCCTAACATTGACCCACCCAAGACCCCTCTC
 
. : . : . : . : . : . :
JMSF008K23- TCCTTCATG
JMFN042K18- TCCTTCATGCAACCTCGCCCGCCTACCCCTTCATCTATCCCCTCCAAGCTCAAAATCAAC
rJMSF026J08+ TCCTTCATGCAACCTCGCCCGCCTACCCCTTCATCTATCCCCTCCAAGCTCAAAATCAAC
rJMSF008K23+ TCCTTCATGCAACCTCGCCCGCCTACCCCTTCATCTATCCCCTCCAAGCTCAAAATCAAC
                      ____________________________________________________________
consensus TCCTTCATGCAACCTCGCCCGCCTACCCCTTCATCTATCCCCTCCAAGCTCAAAATCAAC
 
. : . : . : . : . : . :
JMFN042K18- TTCGTTTTGCCCTATGCTTCCGAGTTCTCCAACAAAGAGGTTGACATGGTTATAGTACCA
rJMSF026J08+ TTCGTTTTGCCCTATGCTTCCGAGTTCTCCAACAAAGAGGTTGACATGGTTATAGTACCA
rJMSF008K23+ TTCGTTTTGCCCTATGCTTCCGAGTTCTCCAACAAAGAGGTTGACATGGTTATAGTACCA
                      ____________________________________________________________
consensus TTCGTTTTGCCCTATGCTTCCGAGTTCTCCAACAAAGAGGTTGACATGGTTATAGTACCA
 
. : . : . : . : . : . :
JMFN042K18- GCAACGACCGGACAGATGGGTATTCTTCCTGGGCATGTCGCAACAATTGCTGAGCTAAAG
rJMSF026J08+ GCAACGACCGGACAGATGGGTATTCTTCCTGGGCATGTCGCAACAATTGCTGAGCTAAAG
rJMSF008K23+ GCAACGACCGGACAGATGGGTATTCTTCCTGGGCATGTCGCAACAATTGCTGAGCTAAAG
                      ____________________________________________________________
consensus GCAACGACCGGACAGATGGGTATTCTTCCTGGGCATGTCGCAACAATTGCTGAGCTAAAG
 
. : . : . : . : . : . :
JMFN042K18- CCTGGTGTCGTGTCTGTGCATGAAGGGAATGATGTGAAGAAATATTTTGTTAGCAGTGGA
rJMSF026J08+ CCTGGTGTCGTGTCTGTGCATGAAGGGAATGATGTGAAGAAATATTTTGTTAGCAGTGGA
rJMSF008K23+ CCTGGTGTCGTGTCTGTGCATGAAGGGAATGATGTGAAGAAATATTTTGTTAGCAGTGGA
                      ____________________________________________________________
consensus CCTGGTGTCGTGTCTGTGCATGAAGGGAATGATGTGAAGAAATATTTTGTTAGCAGTGGA
 
. : . : . : . : . : . :
JMFN042K18- TTTGCGTTTGTCCATTCAAACTCGATTGCTGACATAATGGCTATCGAGGCAATTCCCGTT
rJMSF026J08+ TTTGCGTTTGTCCATTCAAACTCGATTGCTGACATAATGGCTATCGAGGCAATTCCCGTT
rJMSF008K23+ TTTGCGTTTGTCCATTCAAACTCGATTGCTGACATAATGGCTATCGAGGCAATTCCCGTT
                      ____________________________________________________________
consensus TTTGCGTTTGTCCATTCAAACTCGATTGCTGACATAATGGCTATCGAGGCAATTCCCGTT
 
. : . : . : . : . : . :
JMFN042K18- GAACAAATTGATCCAAGCGCTG
rJMSF026J08+ GAACAAATTGATCCAAGCGCTGTGCAGAAGGGGTTGGCAGAGTTCACACAAAAGCTCAAC
rJMSF008K23+ GAACAAATTGATCCAAGCGCTGTGCAGAAGGGGTTGGCAGAGTTCACACAAAAGCTCAAC
                      ____________________________________________________________
consensus GAACAAATTGATCCAAGCGCTGTGCAGAAGGGGTTGGCAGAGTTCACACAAAAGCTCAAC
 
. : . : . : . : . : . :
rJMSF026J08+ TCTGCATCTACTGATTTGCAGAAAGCTGAAGCACAAATTGGGGTGGATGTGCACAGTGCT
rJMSF008K23+ TCTGCATCTACTGATTTGCAGAAAGCTGAAGCACAAATTGGGGTGGATGTGCTCAGTGCT
                      ____________________________________________________________
consensus TCTGCATCTACTGATTTGCAGAAAGCTGAAGCACAAATTGGGGTGGATGTGCTCAGTGCT
 
. : . : . : . : . : . :
rJMSF026J08+ CTTAATTCTGCTCTTACAGGCTAGGTGTGGCTTTCTCTTCTGCTCGGTTCAATAATTATC
rJMSF008K23+ CTTAATTCTGCTCTTACAGGCTAGGTGTGGCTTTCTCTTCTGCTCGGTTCAATAATTATC
                      ____________________________________________________________
consensus CTTAATTCTGCTCTTACAGGCTAGGTGTGGCTTTCTCTTCTGCTCGGTTCAATAATTATC
 
. : . : . : . : . : . :
rJMSF026J08+ TCCCCTTTTGTCTATCTCGACATGCCTCATTAAATCTTCCAATTCCATCCCTTAATCTAG
rJMSF008K23+ TCCCCTTTTGTCTATCTCGACATGCCTCATTAAATCTTCCAATTCCATCCCTTAATCTAG
                      ____________________________________________________________
consensus TCCCCTTTTGTCTATCTCGACATGCCTCATTAAATCTTCCAATTCCATCCCTTAATCTAG
 
. : . : . : . : . : . :
rJMSF026J08+ TACTTCGATTTTTATATTTTCTCTGTTGGATAATGGAATGACAAGTCATTCTTGAAACAA
rJMSF008K23+ TACTTCGATTTTTATATTTTCTCTGTTGGATAATGGAATGACAAGTCATTCTTGAAACAA
                      ____________________________________________________________
consensus TACTTCGATTTTTATATTTTCTCTGTTGGATAATGGAATGACAAGTCATTCTTGAAACAA
 
. : . : . : . : . : . :
rJMSF026J08+ TTATGACACGCCCCTTGGGAAAAACCGAGTGGCAA-CTGGCAAATGCTCTTGTGATGAGA
rJMSF008K23+ TTATGACACGCCCCTTGGGAAAAACCGAGTGGCAACCTGGCAAATGCTCTTGTGATGAGA
                      ____________________________________________________________
consensus TTATGACACGCCCCTTGGGAAAAACCGAGTGGCAACCTGGCAAATGCTCTTGTGATGAGA