Previous Contig 011454:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008J13Sequence410005011 (5)sp|O22224|Y240_ARATH4e-55Protein At2g41620.>gb:AC002510_1530786 Arabidopsis thaliana chromosome 2 clone T766011454 (3)sp|O22224|Y240_ARATH3e-29Protein At2g41620.>gb:AC002510_1530786 Arabidopsis thaliana chromosome 2 clone T
JMSF019F17Sequence446005011 (5)sp|O22224|Y240_ARATH2e-62Protein At2g41620.>gb:AC002510_1530786 Arabidopsis thaliana chromosome 2 clone T733011454 (3)sp|O22224|Y240_ARATH3e-62Protein At2g41620.>gb:AC002510_1530786 Arabidopsis thaliana chromosome 2 clone T
JMSF032D18Sequence678005011 (5)sp|O22224|Y240_ARATH4e-80Protein At2g41620.>gb:AC002510_1530786 Arabidopsis thaliana chromosome 2 clone T818011454 (3)sp|O22224|Y240_ARATH1e-62Protein At2g41620.>gb:AC002510_1530786 Arabidopsis thaliana chromosome 2 clone T

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019F17+ TGATGCAATA
rJMSF032D18+ TTCAGCAGCATTAGATACAACAAATAAGTGCTTATNTGATGCAATA
                      ____________________________________________________________
consensus TTCAGCAGCATTAGATACAACAAATAAGTGCTTATNTGATGCAATA
 
. : . : . : . : . : . :
rJMSF019F17+ TGTGCCCTATCACGTGGAAGGTTGGATGGGGAGAGCCAGGTTTCTGCACTCATTCATTCT
rJMSF032D18+ TGTGCCCTATCACG-GGAAGGTTGGATGGGGAGAGCCAGGTTTCTGCACTCATTCATTCT
                      ____________________________________________________________
consensus TGTGCCCTATCACGTGGAAGGTTGGATGGGGAGAGCCAGGTTTCTGCACTCATTCATTCT
 
. : . : . : . : . : . :
rJMSF019F17+ GGAAATGAGATTTTGGAGACATTCAAGTATTATCCTGATATCAGTCCTCAAGAGAGAGAA
rJMSF032D18+ GGAAATGAGATTTTGGAGACATTCAAGTATTATCCTGATATCAGTCCTCAAGAGAGAGAA
                      ____________________________________________________________
consensus GGAAATGAGATTTTGGAGACATTCAAGTATTATCCTGATATCAGTCCTCAAGAGAGAGAA
 
. : . : . : . : . : . :
rJMSF019F17+ AAGGTTTTGGAACAGCAAACTGTGTTGAGACAGCTTGAGGCAGTCCTGTCCATTCATAAC
rJMSF032D18+ AAGGTTTTGGAACAGCAAACTGTGTTGAGACAGCTTGAGGCAGTCCTGTCCATTCATAAC
                      ____________________________________________________________
consensus AAGGTTTTGGAACAGCAAACTGTGTTGAGACAGCTTGAGGCAGTCCTGTCCATTCATAAC
 
. : . : . : . : . : . :
rJMSF019F17+ TTAGCAAGAATTGGAAACCATTTGGATGCTTTGAAGGAAGTAGCAAAACTACCATTTCTT
rJMSF032D18+ TTAGCAAGAATTGGAAACCATTTGGATGCTTTGAAGGAAGTAGCAAAACTACCATTTCTT
rJMSF008J13+ AACCATTNGGATGC-TTGAAGGAAGTAGCAAAACTACCATTTCTT
                      ____________________________________________________________
consensus TTAGCAAGAATTGGAAACCATTTGGATGCTTTGAAGGAAGTAGCAAAACTACCATTTCTT
 
. : . : . : . : . : . :
rJMSF019F17+ CCTTTGGATCCAAGGACACCGGGTTTTGCCACTGATGTCTTCCAAAATTTGTCTCCCCAT
rJMSF032D18+ CCTTTGGATCCAAGGACACCGGGTTTTGCCACTGATGTCTTCCAAAATTTGTCTCCCCAT
rJMSF008J13+ CCTTTGGATCCAAGGACACCGGGTTTTGCCACTGATGTCTTCCAAAATTTGTCTCCCCAT
                      ____________________________________________________________
consensus CCTTTGGATCCAAGGACACCGGGTTTTGCCACTGATGTCTTCCAAAATTTGTCTCCCCAT
 
. : . : . : . : . : . :
rJMSF019F17+ GTCCAAGCATGTGTTCCAGACCTTCTGAAGGTTGCTCTTCACTGTCTAGACAATGTTAGA
rJMSF032D18+ GTCCAAGCATGTGTTCCAGACCTTCTGAAGGTTGCTCTTCACTGTCTAGACAATGTTAGA
rJMSF008J13+ GTCCAAGCATGTGTTCCAGACCTTCTGAAGGTTGCTCTTCACTGTCTAGACAATGTTAGA
                      ____________________________________________________________
consensus GTCCAAGCATGTGTTCCAGACCTTCTGAAGGTTGCTCTTCACTGTCTAGACAATGTTAGA
 
. : . : . : . : . : . :
rJMSF019F17+ GATACAGATGGATCATTGCGAGCTTTAAGGGAAAAGATAGCGAACTTTCTTGCCAACAAC
rJMSF032D18+ GATACAGATGGATCATTGCGAGCTTTAAGGGAAAAGATAGCGAACTTTCTTGCCAACAAC
rJMSF008J13+ GATACAGATGGATCATTGCGAGCTTTAAGGGAAAAGATAGCGAACTTTCTTGCCAACAAC
                      ____________________________________________________________
consensus GATACAGATGGATCATTGCGAGCTTTAAGGGAAAAGATAGCGAACTTTCTTGCCAACAAC
 
. : . : . : . : . : . :
rJMSF019F17+ TTGGGTAGGAACTGGCCTCGTGATCTATATGAAAAGGTTGCTCAACGTATATGAAGTGCA
rJMSF032D18+ TTGGGTAGGAACTGGCCTCGTGATCTATATGAAAAGGTTGCTCAACGTATATGAAGTGCA
rJMSF008J13+ TTGGGTAGGAACTGGCCTCGTGATCTATATGAAAAGGTTGCTCAACGTATATGAAGTGCA
                      ____________________________________________________________
consensus TTGGGTAGGAACTGGCCTCGTGATCTATATGAAAAGGTTGCTCAACGTATATGAAGTGCA
 
. : . : . : . : . : . :
rJMSF019F17+ TTGCCTCGACCCGTTTTGTGCATTGCCACTGAGGTTTATTATATTATATATTAGTTTCGG
rJMSF032D18+ TTGCCTCGACCCGTTTTGTGCATTGCCACTGAGGTTTATTATATTATATATTAGTTTCGG
rJMSF008J13+ TTGCCTCGACCCGTTTTGTGCATTGCCACTGAGGTTTATTATATTATATATTAGTTTCGG
                      ____________________________________________________________
consensus TTGCCTCGACCCGTTTTGTGCATTGCCACTGAGGTTTATTATATTATATATTAGTTTCGG
 
. : . : . : . : . : . :
rJMSF019F17+ CGTAGGTGCTAAAGTGTTGAATTTTCCCGTCGTCAGTCAATGTATTTGAATCGCTCTAAA
rJMSF032D18+ CGTAGGTGCTAAAGTGTTGAATTTTCCCGTCGTCAGTCAATGTATTTGAATCGCTCTAAA
rJMSF008J13+ CGTAGGTGCTAAAGTGTTGAATTTTCCCGTCGTCAGTCAATGTATTTGAATCGCTCTAAA
                      ____________________________________________________________
consensus CGTAGGTGCTAAAGTGTTGAATTTTCCCGTCGTCAGTCAATGTATTTGAATCGCTCTAAA
 
. : . : . : . : . : . :
rJMSF019F17+ TATAATTTCTCTTGCATTGGCCATCAGTTCTGATAAGGTATATGCTGACTTTGTAATAGA
rJMSF032D18+ TATAATTTCTCTTGCATTGGCCATCAGTTCTGATAAGGTATATGCTGACTTTGTAATAGA
rJMSF008J13+ TATGATTTCTCTTGCATTGGCCATCAGTTCTGATAAGGTATATGCTGACTTTGTAATAGA
                      ____________________________________________________________
consensus TATAATTTCTCTTGCATTGGCCATCAGTTCTGATAAGGTATATGCTGACTTTGTAATAGA
 
. : . : . : . : . : . :
rJMSF019F17+ AAACCCTCCATCCGCCCCCATTGACACCCCTACCGTACCAAACAAAACTCAAAC
rJMSF032D18+ AAACCCTCCATCCGCCCCCATTGACACCCCTACCGTACCAAACAAAACTCAAACTGGAGA
rJMSF008J13+ AAACCCTCCATCCGCCCCCATTGACACCCCTACCGTACCAAACAAAACTCAAACTGGAGA
                      ____________________________________________________________
consensus AAACCCTCCATCCGCCCCCATTGACACCCCTACCGTACCAAACAAAACTCAAACTGGAGA
 
. : . : . : . : . : . :
rJMSF032D18+ TTTGTATCTGGTGATGCCCGAGGCGTATTGAGATCTCTGGTCAACGGAATC
rJMSF008J13+ TTTGTATCTGGTGATGCCCGAGGCGTATTGAGATCTCTGGTCAACGGAATCTGTAATTGT
                      ____________________________________________________________
consensus TTTGTATCTGGTGATGCCCGAGGCGTATTGAGATCTCTGGTCAACGGAATCTGTAATTGT
 
. : . : . : . : . : . :
rJMSF008J13+ AATCTGTTGTTTTCATCCTCATTTGATTAATTCTTAGTCTTCAAATTCCACATATACTGA
                      ____________________________________________________________
consensus AATCTGTTGTTTTCATCCTCATTTGATTAATTCTTAGTCTTCAAATTCCACATATACTGA
 
. : . : . : . : . : . :
rJMSF008J13+ AGCAAACAATGCCAATGTGTTTGATAATATGCATTGTTGCAAGTTCAACAGAAATCTCCA
                      ____________________________________________________________
consensus AGCAAACAATGCCAATGTGTTTGATAATATGCATTGTTGCAAGTTCAACAGAAATCTCCA
 
. : . : . : . : . : . :
rJMSF008J13+ GGTGAAAAAAATCCTAATTGAATGCCTTGAAAGGGATGACCCAAGTGGATGGAGAATGAT
                      ____________________________________________________________
consensus GGTGAAAAAAATCCTAATTGAATGCCTTGAAAGGGATGACCCAAGTGGATGGAGAATGAT