Previous Contig 011448:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008I11Sequence326005001 (2)gb:AY086173_15712285e-14Arabidopsis thaliana clone 21956 mRNA, complete sequence.762011448 (2)gb:AP004678_18432217e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OJ11
JMSF049E04Sequence705005001 (2)gb:AY086173_1571228e-114Arabidopsis thaliana clone 21956 mRNA, complete sequence.778011448 (2)gb:AP004678_18432211e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF049E04+ AACACATTCCGTTTGGTGCTTCACCACAGGATATATGGACTGAATTAGGC
                      ____________________________________________________________
consensus AACACATTCCGTTTGGTGCTTCACCACAGGATATATGGACTGAATTAGGC
 
. : . : . : . : . : . :
rJMSF049E04+ CGACCCTGTGGAATTCACCAAAAACAGGTTGATCAAATGGTGATTCATTCGGCTTCAGAT
rJMSF008I11+ CAAAAACANGTTGATCAAATGGTGATTCATTCGGCTTCAGAT
                      ____________________________________________________________
consensus CGACCCTGTGGAATTCACCAAAAACAGGTTGATCAAATGGTGATTCATTCGGCTTCAGAT
 
. : . : . : . : . : . :
rJMSF049E04+ CCCCGGCCTCGGACTACCCTCTGTGGAGATTATTTTTATAATTACTTTACACGTGGATTA
rJMSF008I11+ CCCCGGCCTCGGACTACCCTCTGTGGAGATTATTTTTATAATTACTTTACACGTGGATTA
                      ____________________________________________________________
consensus CCCCGGCCTCGGACTACCCTCTGTGGAGATTATTTTTATAATTACTTTACACGTGGATTA
 
. : . : . : . : . : . :
rJMSF049E04+ GACATTTTATTCGATGGGCAGACTCATAAAATAAAGAAGTTTGTCTTGCACTCCAACTAT
rJMSF008I11+ GACATTTTATTCGATGGGCAGACTCATAAAATAAAGAAGTTTGTCTTGCACTCCAACTAT
                      ____________________________________________________________
consensus GACATTTTATTCGATGGGCAGACTCATAAAATAAAGAAGTTTGTCTTGCACTCCAACTAT
 
. : . : . : . : . : . :
rJMSF049E04+ CCCGGGCATGCAGATTTTAATTCTTACATGAAGTGCAACTTTGTTATCCACACTTCTGAT
rJMSF008I11+ CCCGGGCATGCAGATTTTAATTCTTACATGAAGTGCAACTTTGTTATCCACACTTCTGAT
                      ____________________________________________________________
consensus CCCGGGCATGCAGATTTTAATTCTTACATGAAGTGCAACTTTGTTATCCACACTTCTGAT
 
. : . : . : . : . : . :
rJMSF049E04+ TTTGGGGATTCGTTTGATCATGAAGTGAACTCTAAGAACTCTATTACACCCAGCACAAAG
rJMSF008I11+ TTTGGGGATTCGTTTGATCATGAAGTGAACTCTAAGAACTCTATTACACCCAGCACAAAG
                      ____________________________________________________________
consensus TTTGGGGATTCGTTTGATCATGAAGTGAACTCTAAGAACTCTATTACACCCAGCACAAAG
 
. : . : . : . : . : . :
rJMSF049E04+ TGGGAACAAGTTAAGGAAATACTCGGGGACTCTGGTCAAGCGGCTATTCAAACACAAGGC
rJMSF008I11+ TGGGAACAAGTTAAGGAAATACTCGGGGACTCTGGTCAAGCGGCTATTCAAACACAAGGC
                      ____________________________________________________________
consensus TGGGAACAAGTTAAGGAAATACTCGGGGACTCTGGTCAAGCGGCTATTCAAACACAAGGC
 
. : . : . : . : . : . :
rJMSF049E04+ TCCACGAGCAACCCATTCGGGTCTACTTTTGTGTATGGTTATCCAAATGTTGCGTTTGAG
rJMSF008I11+ TCCACGAGCAACCCATTCGGGTCTACTTTTGTGTATGGTTATCCAAATGTTGCGTTTGAG
                      ____________________________________________________________
consensus TCCACGAGCAACCCATTCGGGTCTACTTTTGTGTATGGTTATCCAAATGTTGCGTTTGAG
 
. : . : . : . : . : . :
rJMSF049E04+ GTGATGAAGAATGGCCACATTGCTACCGTAACGCTCTTTCAGTCATGATTTATAATGGCT
rJMSF008I11+ GTGATGAAGAATGGCCACATTGCTACCGTAACGCTCTTTCAGTCATGATTTATAATGGCT
                      ____________________________________________________________
consensus GTGATGAAGAATGGCCACATTGCTACCGTAACGCTCTTTCAGTCATGATTTATAATGGCT
 
. : . : . : . : . : . :
rJMSF049E04+ TCGGGTTGGAATCGTAAATCATGATTTCCAGAAGAAAGCATGCCCGGTGTCCTGGTTGCA
rJMSF008I11+ TCGGGTTGGAATCGTAAATCATGATTTCCAGAAGAAAGCATGCCCGGTGTCCTGGTTGCA
                      ____________________________________________________________
consensus TCGGGTTGGAATCGTAAATCATGATTTCCAGAAGAAAGCATGCCCGGTGTCCTGGTTGCA
 
. : . : . : . : . : . :
rJMSF049E04+ ATCGCGGTGGAAGTGTCTGTGTCTCTATATATACTATATATACAGCTTTCTTCTATTGTA
rJMSF008I11+ ATCGCGGTGGAAGTGTCTGTGTCTCTATATATACTATATATACAGCTTTCTTCTATTGTA
                      ____________________________________________________________
consensus ATCGCGGTGGAAGTGTCTGTGTCTCTATATATACTATATATACAGCTTTCTTCTATTGTA
 
. : . : . : . : . : . :
rJMSF049E04+ TAGTTAATGCCAAGATCATAGCACCTAACTGGGGAAATTGTGTATTTGATTAAATCTGTA
rJMSF008I11+ TAGTTAATGCCAAGATCATAGCACCTAACTGGGGAAATTGTGTATTTGATTAAATCTGTA
                      ____________________________________________________________
consensus TAGTTAATGCCAAGATCATAGCACCTAACTGGGGAAATTGTGTATTTGATTAAATCTGTA
 
. : . : . : . : . : . :
rJMSF049E04+ CATATGTGGAATGACACATTGGTTGTAGTTGTATGGTCTCCAAGCTGTTGTGA-TTAACT
rJMSF008I11+ CATATGTGGAATGACACATTGGTTGTAGTTGTATGGTCTCCAAGCTGTTGTGATTTAACT
                      ____________________________________________________________
consensus CATATGTGGAATGACACATTGGTTGTAGTTGTATGGTCTCCAAGCTGTTGTGATTTAACT
 
. : . : . : . : . : . :
rJMSF049E04+ GACCCAAGT
rJMSF008I11+ GACCCAAGTTTGTGTATTACAATGAAGAATCGATCAGTGTGGAGAACCGGAGATGTGGCT
                      ____________________________________________________________
consensus GACCCAAGTTTGTGTATTACAATGAAGAATCGATCAGTGTGGAGAACCGGAGATGTGGCT