Previous Contig 011444:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN020A08Sequence611011444 (3)gb:AF481952_18039371e-52Petunia x hybrida hairy meristem (HAM) mRNA, complete cds.
JMSF008H13Sequence447003217 (3)711011444 (3)gb:AF481952_18039373e-33Petunia x hybrida hairy meristem (HAM) mRNA, complete cds.
JMSF032B14Sequence655003217 (3)719011444 (3)gb:AF481952_18039373e-39Petunia x hybrida hairy meristem (HAM) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN020A08- CACCGAGCCAC
                      ____________________________________________________________
consensus CACCGAGCCAC
 
. : . : . : . : . : . :
JMFN020A08- ACTCCCTTTGCTGCTGCATTATATAAAGCAGCTTTCGCCCAAAGTTGTGGTTTCTCTGGC
                      ____________________________________________________________
consensus ACTCCCTTTGCTGCTGCATTATATAAAGCAGCTTTCGCCCAAAGTTGTGGTTTCTCTGGC
 
. : . : . : . : . : . :
JMFN020A08- CCGTGGATATGAACGAACCGAGCTCCCGTTCCCACACCACCTCCTCAACGCCCTTCAATA
rJMSF032B14+ TTCCCACACCACCTCCTCAACGCCCTTCAATA
                      ____________________________________________________________
consensus CCGTGGATATGAACGAACCGAGCTCCCGTTCCCACACCACCTCCTCAACGCCCTTCAATA
 
. : . : . : . : . : . :
JMFN020A08- CTTCGAGGCTCTTTTCGAGAGCATCGATGCGGGTAACGTGACACCAGACGCATCAAACAA
rJMSF032B14+ CTTCGAGGCTCTTTTCGAGAGCATCGATGCGGGTAACGTGACACCAGACGCATCAAACAA
rJMSF008H13+ TCTTTTCGAGAGCATCGATGCGGGTAACGTGACACCAGACGCATCAAACAA
                      ____________________________________________________________
consensus CTTCGAGGCTCTTTTCGAGAGCATCGATGCGGGTAACGTGACACCAGACGCATCAAACAA
 
. : . : . : . : . : . :
JMFN020A08- GATCGAACGGTTCCTCTTCCAGCCTAGCATCGAGAGCATCGTGTTTGGGCACCTCCGTTT
rJMSF032B14+ GATCGAACGGTTCCTCTTCCAGCCTAGCATCGAGAGCATCGTGTTTGGGCACCTCCGTTT
rJMSF008H13+ GATCGAACGGTTCCTCTTCCAGCCTAGCATCGAGAGCATCGTGTTTGGGCACCTCCGTTT
                      ____________________________________________________________
consensus GATCGAACGGTTCCTCTTCCAGCCTAGCATCGAGAGCATCGTGTTTGGGCACCTCCGTTT
 
. : . : . : . : . : . :
JMFN020A08- CCCCGACCAAATGCCTCCCTGGAGAAACCTCTTCGCATCCGCCGGGTTCCAACCACACCC
rJMSF032B14+ CCCCGACCAAATGCCTCCCTGGAGAAACCTCTTCGCATCCGCCGGGTTCCAACCACACCC
rJMSF008H13+ CCCCGACCAAATGCCTCCCTGGAGAAACCTCTTCGCATCCGCCGGGTTCCAACCACACCC
                      ____________________________________________________________
consensus CCCCGACCAAATGCCTCCCTGGAGAAACCTCTTCGCATCCGCCGGGTTCCAACCACACCC
 
. : . : . : . : . : . :
JMFN020A08- GTTTAGCAACTTCGCTGAAACCCAAGCTGAATGTGTCGTGAAAAGAACCGAAACCCGGGG
rJMSF032B14+ GTTTAGCAACTTCGCTGAAACCCAAGCTGAATGTGTCGTGAAAAGAACCGAAACCCGGGG
rJMSF008H13+ GTTTAGCAACTTCGCTGAAACCCAAGCTGAATGTGTCGTGAAAAGAACCGAAACCCGGGG
                      ____________________________________________________________
consensus GTTTAGCAACTTCGCTGAAACCCAAGCTGAATGTGTCGTGAAAAGAACCGAAACCCGGGG
 
. : . : . : . : . : . :
JMFN020A08- ATTCCACGTGCAGAAGCACCACGCATCGCTCGCCCTTTGCTGGCAAAACCGGGAGCTACT
rJMSF032B14+ ATTCCACGTGCAGAAGCACCACGCATCGCTCGCCCTTTGCTGGCAAAACCGGGAGCTACT
rJMSF008H13+ ATTCCACGTGCAGAAGCACCACGCATCGCTCGCCCTTTGCTGGCAAAACCGGGAGCTACT
                      ____________________________________________________________
consensus ATTCCACGTGCAGAAGCACCACGCATCGCTCGCCCTTTGCTGGCAAAACCGGGAGCTACT
 
. : . : . : . : . : . :
JMFN020A08- CTCAGCTACGGCTTGGAGGTGCTGAAGAACTTAACGGATATTCGATATCTTATATGGAGT
rJMSF032B14+ CTCAGCTACGGCTTGGAGGTGCTGAAGAACTTAACGGATATTCGATATCTTATATGGAGT
rJMSF008H13+ CTCAGCTACGGCTTGGAGGTGCTGAAGAACTTAACGGATATTCGATATCTTATATGGAGT
                      ____________________________________________________________
consensus CTCAGCTACGGCTTGGAGGTGCTGAAGAACTTAACGGATATTCGATATCTTATATGGAGT
 
. : . : . : . : . : . :
JMFN020A08- GAGTTTTCTTCCTTCTTGCAAGCCTATTTTGGTATTGTCTATTCTATTATGTAGTGTTAA
rJMSF032B14+ GAGTTTTCTTCCTTCTTGCAAGCCTATTTTGGTATTGTCTATTCTATTATGTAGTGTTAA
rJMSF008H13+ GAGTTTTCTTCCTTCTTGCAAGCCTATTTTGGTATTGTCTATTCTATTATGTAGTGTTAA
                      ____________________________________________________________
consensus GAGTTTTCTTCCTTCTTGCAAGCCTATTTTGGTATTGTCTATTCTATTATGTAGTGTTAA
 
. : . : . : . : . : . :
JMFN020A08- CTGCAGAC-AAAAATTGTCGATTAACTGATTATTTACGTGTAGGGTTATCTGTTTGGACA
rJMSF032B14+ CTGCAGACAAAAAATTGTCGATTAACTGATTATTTACGTGTAGGGTTATCTGTTTGGACA
rJMSF008H13+ CTGCAGACAAAAAATTGTCGATTAACTGATTATTTACGTGTAGGGTTATCTGTTTGGACA
                      ____________________________________________________________
consensus CTGCAGACAAAAAATTGTCGATTAACTGATTATTTACGTGTAGGGTTATCTGTTTGGACA
 
. : . : . : . : . : . :
JMFN020A08- T
rJMSF032B14+ TCTTTCATGCACTGCCTATGAGTTAACTGTGATGTCTGTTAACTATATTTCTGGAAGTTA
rJMSF008H13+ TCTTTCATGCACTGCCTATGAGTTAACTGTGATGTCTGTTAACTATATTTCTGGAAGTTA
                      ____________________________________________________________
consensus TCTTTCATGCACTGCCTATGAGTTAACTGTGATGTCTGTTAACTATATTTCTGGAAGTTA
 
. : . : . : . : . : . :
rJMSF032B14+ AAAGCAGTTGGGAAGTAGAAAGATTTGGTTTCAATGTATTGCTGTTTCTATCTGGTCTTC
rJMSF008H13+ AAAGCAGTTGGGAAGTAGAAAGATTTGGTTTCAATGTATTGCTGTTTCTATCTGGTCTTC
                      ____________________________________________________________
consensus AAAGCAGTTGGGAAGTAGAAAGATTTGGTTTCAATGTATTGCTGTTTCTATCTGGTCTTC
 
. : . : . : . : . : . :
rJMSF032B14+ CTAGGATGTTTGATAACTGTTGTTGGTTGGTTTAGAGTGGTAGACTTCTAGTTTGTTGTG
rJMSF008H13+ CTAGGATGTTTGATAACTGTTGTTGGTTGGTTTAGAGTGGTAGACTTCTAGTTTGTTGTG
                      ____________________________________________________________
consensus CTAGGATGTTTGATAACTGTTGTTGGTTGGTTTAGAGTGGTAGACTTCTAGTTTGTTGTG
 
. : . : . : . : . : . :
rJMSF032B14+ ATTATTGTGTGTTTAATAGTACTATGT
rJMSF008H13+ ATTATTGTGTGTTTAATAGTACTATGTTACATTTGGGGTCTAATTGAGACTTTGTGCGAT
                      ____________________________________________________________
consensus ATTATTGTGTGTTTAATAGTACTATGTTACATTTGGGGTCTAATTGAGACTTTGTGCGAT