Previous Contig 011442:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008D19Sequence349011442 (3)gb:BT005879_16388014e-38Arabidopsis thaliana At5g06710 gene, complete cds.487011442 (3)gb:BT005879_16388014e-38Arabidopsis thaliana At5g06710 gene, complete cds.
JMSF008H01Sequence381018571755011442 (3)sp|P46665|HT14_ARATH5e-54Homeobox-leucine zipper protein HAT14 (HD-ZIP protein 14).>gb:ATH431182_1552569

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF008H01+ TCTCCGNACAGCGCGGCGTCGTCCTTCAAGATGGA
                      ____________________________________________________________
consensus TCTCCGNACAGCGCGGCGTCGTCCTTCAAGATGGA
 
. : . : . : . : . : . :
rJMSF008H01+ CTTCTCGATCTTCAGAAACGGGCTGTTGGGGAAGAGAGATAGCACCGGCGACGGCGATAG
                      ____________________________________________________________
consensus CTTCTCGATCTTCAGAAACGGGCTGTTGGGGAAGAGAGATAGCACCGGCGACGGCGATAG
 
. : . : . : . : . : . :
rJMSF008H01+ AGAGAGAGGCGGCTCTTCCAATTCCCGAGCCTCCGACGACGACGAGAACGGCCTCGGCCG
                      ____________________________________________________________
consensus AGAGAGAGGCGGCTCTTCCAATTCCCGAGCCTCCGACGACGACGAGAACGGCCTCGGCCG
 
. : . : . : . : . : . :
rJMSF008D19+ AAAGCTTCAAAGAACA
JMSF008D19- AAAGCTTCAAAGAACA
rJMSF008H01+ GAAAAAGCTCCGCCTCACCAAAGATCAGTCAGCTTTTCTCGAGGAAAGCTTCAAAGAACA
                      ____________________________________________________________
consensus GAAAAAGCTCCGCCTCACCAAAGATCAGTCAGCTTTTCTCGAGGAAAGCTTCAAAGAACA
 
. : . : . : . : . : . :
rJMSF008D19+ CAACACTCTCAACCCCAAACAAAAACTCGCTTTAGCAAAACAACTCAATCTTCGTCCTCG
JMSF008D19- CAACACTCTCAACCCCAAACAAAAACTCGCTTTAGCAAAACAACTCAATCTTCGTCCTCG
rJMSF008H01+ CAACACTCTCAACCCCAAACAAAAACTCGCTTTAGCAAAACAACTCAATCTTCGTCCTCG
                      ____________________________________________________________
consensus CAACACTCTCAACCCCAAACAAAAACTCGCTTTAGCAAAACAACTCAATCTTCGTCCTCG
 
. : . : . : . : . : . :
rJMSF008D19+ CCAAGTCGAAGTTTGGTTCCAGAACAGAAGAGCAAGGACGAAGTTGAAGCAGACAGAAGT
JMSF008D19- CCAAGTCGAAGTTTGGTTCCAGAACAGAAGAGCAAGGACGAAGTTGAAGCAGACAGAAGT
rJMSF008H01+ CCAAGTCGAAGTTTGGTTCCAGAACAGAAGAGCAAGGACGAAGTTGAAGCAGACAGAAGT
                      ____________________________________________________________
consensus CCAAGTCGAAGTTTGGTTCCAGAACAGAAGAGCAAGGACGAAGTTGAAGCAGACAGAAGT
 
. : . : . : . : . : . :
rJMSF008D19+ GGATTGCGAGTATTTAAAGCGGTGTTGCGAGACGCTGACAGAAGAGAACCGAAGATTACA
JMSF008D19- GGATTGCGAGTATTTAAAGCGGTGTTGCGAGACGCTGACAGAAGAGAACCGAAGATTACA
rJMSF008H01+ GGATTGCGAGTATTTAAAGCGGTGTTGCGAGACGCTGACAGAAGAGAACCGAAGATTACA
                      ____________________________________________________________
consensus GGATTGCGAGTATTTAAAGCGGTGTTGCGAGACGCTGACAGAAGAGAACCGAAGATTACA
 
. : . : . : . : . : . :
rJMSF008D19+ GAAAGAGCTTCAAGAATTGAGGGCTTTGAAGGCGTCTCAGCCCTTCTACATGCAGCTTCC
JMSF008D19- GAAAGAGCTTCAAGAATTGAGGGCTTTGAAGGCGTCTCAGCCCTTCTACATGCAGCTTCC
rJMSF008H01+ GAAAGAGCTTCAAGAATTGAGGGCTTTGAAGGCGTCTCAGCCCTTCTACATGCAGCTTCC
                      ____________________________________________________________
consensus GAAAGAGCTTCAAGAATTGAGGGCTTTGAAGGCGTCTCAGCCCTTCTACATGCAGCTTCC
 
. : . : . : . : . : . :
rJMSF008D19+ GGCCACCACTCTCACCATGTGTCCGTCGTGCGAGCGCGTTGCCTCTTCCACCGCCGCCGC
JMSF008D19- GGCCACCACTCTCACCATGTGTCCGTCGTGCGAGCGCGTTGCCTCTTCCACCGCCGCCGC
rJMSF008H01+ GGCCACCACTCTCACCATGTGTCCGTCGTGCGAGCGCGTTGCCTCTTCCACCGCCGCCGC
                      ____________________________________________________________
consensus GGCCACCACTCTCACCATGTGTCCGTCGTGCGAGCGCGTTGCCTCTTCCACCGCCGCCGC
 
. : . : . : . : . : . :
rJMSF008D19+ TACCCCGACTACTGCCGCCGCCGCCCACGGCGGCGCTAAGCCCAAACTCTTCCCGTTTCC
JMSF008D19- TACCCCGACTACTGGCGCCGCCGCCCACGGCGG
rJMSF008H01+ TACCCCGACTACTGCCGCCGCCGCCCACGGCGGCGCTAAGCCCAAACTCTTCCCGTTTCC
                      ____________________________________________________________
consensus TACCCCGACTACTGCCGCCGCCGCCCACGGCGGCGCTAAGCCCAAACTCTTCCCGTTTCC
 
. : . : . : . : . : . :
rJMSF008D19+ GCCCCCGCAAGTGCATGCTCCCCAGGCTGCTTCGTGATTACTTTTTTGTGTTAATTAGGG
rJMSF008H01+ GCCCCCGCAAGTGCATGCTCCCCAGGCTGCTTCGTGATTACTTTTTTGTGTTAATTAGGC
                      ____________________________________________________________
consensus GCCCCCGCAAGTGCATGCTCCCCAGGCTGCTTCGTGATTACTTTTTTGTGTTAATTAGGG
 
. : . : . : . : . : . :
rJMSF008D19+ TAATGACTGTTAGTATACGGTGTAGTCTTCTGCTTCTATATGTACATATCA
rJMSF008H01+ TAATGACTGTTAGTATACGGTGTAGTCTTCTGCTTCTATATGTACATATCAACATTTTGA
                      ____________________________________________________________
consensus TAATGACTGTTAGTATACGGTGTAGTCTTCTGCTTCTATATGTACATATCAACATTTTGA
 
. : . : . : . : . : . :
rJMSF008H01+ TTCTCCATTTTACTTGTCTTAATCCCAGACCATAGTTTTCGGGAACTTTTACCATATATC
                      ____________________________________________________________
consensus TTCTCCATTTTACTTGTCTTAATCCCAGACCATAGTTTTCGGGAACTTTTACCATATATC