Previous Contig 011438:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008G07Sequence363011438 (4)gb:AY589705_16165829e-50Mirabilis jalapa clone FS-46 cap-binding protein mRNA, partial cds.779011438 (4)gb:AB005239_15094518e-69Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MLN1.>gb:BT004813_16378
JMSF021O08Sequence690006464 (4)sp|Q9FY06|PPF1_PEA1e-68Inner membrane protein PPF-1, chloroplast precursor (Post-floral- specific prote754011438 (4)gb:AB005239_15094517e-69Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MLN1.>gb:BT004813_16378
JMSF039H17Sequence559006432 (12)921011438 (4)gb:AB005239_15094512e-79Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MLN1.>gb:BT004813_16378

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF008G07- GCTGGGGCTAACCTGGGAAGGATTTCTCTGAGGAGAAAGAACAATGGCATCTCTCT
                      ____________________________________________________________
consensus GCTGGGGCTAACCTGGGAAGGATTTCTCTGAGGAGAAAGAACAATGGCATCTCTCT
 
. : . : . : . : . : . :
JMSF008G07- TCAAGGATCTCAGCAAGATTTCAGCCTACAGAGATAGAAGGTTCCAGGGGACACAGGAAG
rJMSF039H17+ TCAGCAAGATTTCAGCCTACAGAGATAGAAGGTTCCAGGGGACACAGGAAG
                      ____________________________________________________________
consensus TCAAGGATCTCAGCAAGATTTCAGCCTACAGAGATAGAAGGTTCCAGGGGACACAGGAAG
 
. : . : . : . : . : . :
JMSF008G07- AATTTGAGGAAGCTCTGCTTAAATCTACTACTGTTTATGTGGGGAACATGTCCTTCTATA
rJMSF039H17+ AATTTGAGGAAGCTCTGCTTAAATCTACTACTGTTTATGTGGGGAACATGTCCTTCTATA
                      ____________________________________________________________
consensus AATTTGAGGAAGCTCTGCTTAAATCTACTACTGTTTATGTGGGGAACATGTCCTTCTATA
 
. : . : . : . : . : . :
JMSF008G07- CGACTGAGGAGCAAGTTTACGAGCTGTTCTCTCGTGCTGGAGAGATAAAAAAGATTGTCA
rJMSF039H17+ CGACTGAGGAGCAAGTTTACGAGCTGTTCTCTCGTGCTGGAGAGATAAAAAAGATTGTCA
                      ____________________________________________________________
consensus CGACTGAGGAGCAAGTTTACGAGCTGTTCTCTCGTGCTGGAGAGATAAAAAAGATTGTCA
 
. : . : . : . : . : . :
JMSF008G07- TGGGTCTTGACAAGAACAGCAGAACTCCATGTGGTTTCTGTTTTGTGAT
rJMSF039H17+ TGGGTCTTGACAAGAACAGCAGAACTCCATGTGGTTTCTGTTTTGTGATAGGAAAGGGAA
                      ____________________________________________________________
consensus TGGGTCTTGACAAGAACAGCAGAACTCCATGTGGTTTCTGTTTTGTGATAGGAAAGGGAA
 
. : . : . : . : . : . :
rJMSF039H17+ CTAGGGAAGTGCTGAAAGATGAGCAAGTAATCACTAATTTTAAATAATTTTCATACCAGA
rJMSF021O08+ AGA
rJMSF008G07+ AGA
                      ____________________________________________________________
consensus CTAGGGAAGTGCTGAAAGATGAGCAAGTAATCACTAATTTTAAATAATTTTCATACCAGA
 
. : . : . : . : . : . :
rJMSF039H17+ TTTTGATTGGGGTTTCATGGAAGGCAGACAGTGGGGTCGCGGTAAAAGTGGAGGACAAGT
rJMSF021O08+ TTTTGATTGGGGTTTCATGGAAGGCAGACAGTGGGGTCGCGGTAAAAGTGGAGGACAAGT
rJMSF008G07+ TTTTGATTGGGGTTTCATGGAAGGCAGACAGTGGGGTCGCGGTAAAAGTGGAGGACAAGT
                      ____________________________________________________________
consensus TTTTGATTGGGGTTTCATGGAAGGCAGACAGTGGGGTCGCGGTAAAAGTGGAGGACAAGT
 
. : . : . : . : . : . :
rJMSF039H17+ ACGCGATGAATATCGCACTGATTATGATCCAGGTAGGGGTGGTTATGGAAAGTTGGTGCA
rJMSF021O08+ ACGCGATGAATATCGCACTGATTATGATCCAGGTAGGGGTGGTTATGGAAAGTTGGTGCA
rJMSF008G07+ ACGCGATGAATATCGCACTGATTATGATCCAGGTAGGGGTGGTTATGGAAAGTTGGTGCA
                      ____________________________________________________________
consensus ACGCGATGAATATCGCACTGATTATGATCCAGGTAGGGGTGGTTATGGAAAGTTGGTGCA
 
. : . : . : . : . : . :
rJMSF039H17+ AAAGGAGTTGGAAGCACAGAGACAACTTGTGGATTATGGTACTGGATCATTGGGCAACTT
rJMSF021O08+ AAAGGAGTTGGAAGCACAGAGACAACTTGTGGATTATGGTACTGGATCATTGGGCAACTT
rJMSF008G07+ AAAGGAGTTGGAAGCACAGAGACAACTTGTGGATTATGGTACTGGATCATTGGGCAACTT
                      ____________________________________________________________
consensus AAAGGAGTTGGAAGCACAGAGACAACTTGTGGATTATGGTACTGGATCATTGGGCAACTT
 
. : . : . : . : . : . :
rJMSF039H17+ CCCACCTGTTATGGCACCTCAATATGGTCGGCAAGGTGGACATGGGGGTTCTTATCGACA
rJMSF021O08+ CCCACCTGTTATGGCACCTCAATATGGTCGGCAAGGTGGACATGGGGGTTCTTATCGACA
rJMSF008G07+ CCCACCTGTTATGGCACCTCAATATGGTCGGCAAGGTGGACATGGGGGTTCTTATCGACA
                      ____________________________________________________________
consensus CCCACCTGTTATGGCACCTCAATATGGTCGGCAAGGTGGACATGGGGGTTCTTATCGACA
 
. : . : . : . : . : . :
rJMSF039H17+ TGGCAGAGATTACTATCGCAAGAGGCATCGTGAAGATGATCGCCACAGACTTGATTACTC
rJMSF021O08+ TGGCAGAGATTACTATCGCAAGAGGCATCGTGAAGATGATCGCCACAGACTTGATTACTC
rJMSF008G07+ TGGCAGAGATTACTATCGCAAGAGGCATCGTGAAGATGATCGCCACAGACTTGATTACTC
                      ____________________________________________________________
consensus TGGCAGAGATTACTATCGCAAGAGGCATCGTGAAGATGATCGCCACAGACTTGATTACTC
 
. : . : . : . : . : . :
rJMSF039H17+ AAAGAGAGTTTACCGCCGTGAACCTGTGAGAGACTCCGACCATGAAGCTCGACCGGAGAA
rJMSF021O08+ AAAGAGAGTTTACCGCCGTGAACCTGTGAGAGACTCCGACCATGAAGCTCGACCGGAGAA
rJMSF008G07+ AAAGAGAGTTTACCGCCGTGAACCTGTGAGAGACTCCGACCATGAAGCTCGACCGGAGAA
                      ____________________________________________________________
consensus AAAGAGAGTTTACCGCCGTGAACCTGTGAGAGACTCCGACCATGAAGCTCGACCGGAGAA
 
. : . : . : . : . : . :
rJMSF039H17+ GAATCCACGTTTCCGTGAAAGTGGTGACTCCGATGAAGAAGATGACGACGATCAGAAGCA
rJMSF021O08+ GAATCCACGTTTCCGTGAAAGTGGTGACTCCGATGAAGAAGATGACGACGATCAGAAGCA
rJMSF008G07+ GAATCCACGTTTCCGTGAAAGTGGTGACTCCGATGAAGAAGATGACGACGATCAGAAGCA
                      ____________________________________________________________
consensus GAATCCACGTTTCCGTGAAAGTGGTGACTCCGATGAAGAAGATGACGACGATCAGAAGCA
 
. : . : . : . : . : . :
rJMSF039H17+ ATCCCATTAGTCACTTCCAAGGAATCTCGTTATCGTGTCTAGAGTTTGCGGCCCCTCCCG
rJMSF021O08+ ATCCCATTAGTCACTTCCAAGGAATCTCGTTATCGTGTCTAGAGTTTGCGGCCCCTCCCG
rJMSF008G07+ ATCCCATTAGTCACTTCCAAGGAATCTCGTTATCGTGTCTAGAGTTTGCGGCCCCTCCCG
                      ____________________________________________________________
consensus ATCCCATTAGTCACTTCCAAGGAATCTCGTTATCGTGTCTAGAGTTTGCGGCCCCTCCCG
 
. : . : . : . : . : . :
rJMSF039H17+ TGGAAAGAAACCTTTCGACTAAGATTTTCTTTCCTATTCCTTCCCATATCTGCCGGGTTG
rJMSF021O08+ TGGAAAGAAACCTTTCGACTAAGATTTTCTTTCCTATTCCTTCCCATATCTGCCGGGTTG
rJMSF008G07+ TGGAAAGAAACCTTTCGACTAAGATTTTCTTTCCTATTCCTTCCCATATCTGCCGGGTTG
                      ____________________________________________________________
consensus TGGAAAGAAACCTTTCGACTAAGATTTTCTTTCCTATTCCTTCCCATATCTGCCGGGTTG
 
. : . : . : . : . : . :
rJMSF039H17+ TGGCCATTTCATTTTTAGTCGCTTAAAGTAGCATTTCTCTGTATACTGCTTTGCATTACA
rJMSF021O08+ TGGCCATTTCATTTTTAGTCGCTTAAAGTAGCATTTCTCTGTATACTGCTTTGCATTACA
rJMSF008G07+ TGGCCATTTCATTTTTAGTCGCTTAAAGTAGCATTTCTCTGTATACTGCTTTGCATTACA
                      ____________________________________________________________
consensus TGGCCATTTCATTTTTAGTCGCTTAAAGTAGCATTTCTCTGTATACTGCTTTGCATTACA
 
. : . : . : . : . : . :
rJMSF039H17+ GACTTGCAGATATTGTGTACTGAAAACT
rJMSF021O08+ GACTTGCAGATATTGTGTACTGAAAACT
rJMSF008G07+ GACTTGCAGATATTGTGTACTGAAAACTTGGGTAGAGTTCAGTGATCTAGAGCTGCCTTG
                      ____________________________________________________________
consensus GACTTGCAGATATTGTGTACTGAAAACTTGGGTAGAGTTCAGTGATCTAGAGCTGCCTTG