Previous Contig 011430:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008E22Sequence363004977 (2)gb:ATF28O9_15503701e-08Arabidopsis thaliana DNA chromosome 3, BAC clone F28O9.722011430 (2)pir|T47777|T477771e-30hypothetical protein F24I3.250 - Arabidopsis thaliana>gb:ATF24I3_1549916 Arabido
JMSF038M04Sequence683004977 (2)gb:ATF28O9_15503701e-21Arabidopsis thaliana DNA chromosome 3, BAC clone F28O9.857011430 (2)pir|T47777|T477771e-46hypothetical protein F24I3.250 - Arabidopsis thaliana>gb:ATF24I3_1549916 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038M04+ TTTTCAGGGGCAGAAAATG
                      ____________________________________________________________
consensus TTTTCAGGGGCAGAAAATG
 
. : . : . : . : . : . :
rJMSF038M04+ GAATCCTCTTCGGCAGAGATTAGACAGCTATGGTTACACAGTGGAGCAACATGTTGTTGG
                      ____________________________________________________________
consensus GAATCCTCTTCGGCAGAGATTAGACAGCTATGGTTACACAGTGGAGCAACATGTTGTTGG
 
. : . : . : . : . : . :
rJMSF038M04+ CTCACTTCTATTTACTCCCCTGTTGCTTCTACTCCCAACGGTTTCTGCATTCTATATTTT
rJMSF008E22+ TTT
                      ____________________________________________________________
consensus CTCACTTCTATTTACTCCCCTGTTGCTTCTACTCCCAACGGTTTCTGCATTCTATATTTT
 
. : . : . : . : . : . :
rJMSF038M04+ CTTCACAATTTTGAATGCAACTATAAGCTTGATATGCATAGTTATTGAACTTGGGATCTT
rJMSF008E22+ CTTCACAATTTTGAATGCAACTATAAGCTTGATATGCATAGTTATTGAACTTGGGATCTT
                      ____________________________________________________________
consensus CTTCACAATTTTGAATGCAACTATAAGCTTGATATGCATAGTTATTGAACTTGGGATCTT
 
. : . : . : . : . : . :
rJMSF038M04+ AGTTATTCATGCCACACCATATACTAAAGTTTCTGTTTGGTTGGTGAGGAAGAAAAGATT
rJMSF008E22+ AGTTATTCATGCCACACCATATACTAAAGTTGCTGTTTGGTTGGTGAGGAAGAAAAGATT
                      ____________________________________________________________
consensus AGTTATTCATGCCACACCATATACTAAAGTTTCTGTTTGGTTGGTGAGGAAGAAAAGATT
 
. : . : . : . : . : . :
rJMSF038M04+ TCCTTCTGGGATATGGTTTGAAATTGTGTCTAGTCAATGTGATGTTACCAATTCTTCACA
rJMSF008E22+ TCCTTCTGGGATATGGTTTGAAATTGTGTCTAGTCAATGTGATGTTACCAATTCTTCACA
                      ____________________________________________________________
consensus TCCTTCTGGGATATGGTTTGAAATTGTGTCTAGTCAATGTGATGTTACCAATTCTTCACA
 
. : . : . : . : . : . :
rJMSF038M04+ CACTGGGTCTGCGGCTGAAATTAATCTGGAACCTAGTGCACATTGCTTCAAATCATTGGC
rJMSF008E22+ CACTGGGTCTGCGGCTGAAATTAATCTGGAACCTAGTGCACATTGCTTCAAATCATTGGC
                      ____________________________________________________________
consensus CACTGGGTCTGCGGCTGAAATTAATCTGGAACCTAGTGCACATTGCTTCAAATCATTGGC
 
. : . : . : . : . : . :
rJMSF038M04+ TGTGGTTTCATTTTTGCGTGGCAACTGTCTGAGCTTAAGAGAAGTTGTTTCACCCCACTA
rJMSF008E22+ TGTGGTTTCATTTTTGCGTGGCAACTGTCTGAGCTTAAGAGAAGTTGTTTCACCCCACTA
                      ____________________________________________________________
consensus TGTGGTTTCATTTTTGCGTGGCAACTGTCTGAGCTTAAGAGAAGTTGTTTCACCCCACTA
 
. : . : . : . : . : . :
rJMSF038M04+ TAGATGCGTGTTTTCAGCAATTTCAAGGTCCTCGATGGCATTGTCAGCTTATGGAATTCT
rJMSF008E22+ TAGATGCGTGTTTTCAGCAATTTCAAGGTCCTCGATGGCATTGTCAGCTTATGGAATTCT
                      ____________________________________________________________
consensus TAGATGCGTGTTTTCAGCAATTTCAAGGTCCTCGATGGCATTGTCAGCTTATGGAATTCT
 
. : . : . : . : . : . :
rJMSF038M04+ TACGGGGAAAAGTATTTCGTATACTCTGGGCACTGGGCAACACATGAAGTTGCCATGGAT
rJMSF008E22+ TACGGGGAAAAGTATTTCGTATACTCTGGGCACTGGGCAACACATGAAGTTGCCATGGAT
                      ____________________________________________________________
consensus TACGGGGAAAAGTATTTCGTATACTCTGGGCACTGGGCAACACATGAAGTTGCCATGGAT
 
. : . : . : . : . : . :
rJMSF038M04+ GGTCATCCCATGCAAAGCCTATTGGCGTCTTTGTCGTGATGCAATCCTTGCTAGAAGGGA
rJMSF008E22+ GGTCATCCCATGCAAAGCCTATTGGCGTCTTTGTCGTGATGCAATCCTTGCTAGAAGGGA
                      ____________________________________________________________
consensus GGTCATCCCATGCAAAGCCTATTGGCGTCTTTGTCGTGATGCAATCCTTGCTAGAAGGGA
 
. : . : . : . : . : . :
rJMSF038M04+ AGACTGATTGCAGCTTGTAGCATTAAGCAGATAATGTTTGGTTCTTGCGGTGGCCTATCT
rJMSF008E22+ AGACTGATTGCAGCTTGTAGCATTAAGCAGATAATGTTTGGTTCTTGCGGTGGCCTATCT
                      ____________________________________________________________
consensus AGACTGATTGCAGCTTGTAGCATTAAGCAGATAATGTTTGGTTCTTGCGGTGGCCTATCT
 
. : . : . : . : . : . :
rJMSF038M04+ ACAGTTCCAATTTCACATTTGATATCTTTTATCTAGTGCCTTTAAATTGTTTTCTCAGGT
rJMSF008E22+ ACAGTTCCAATTTCACATTTGATATCTTTTATCTAGTGCCTTTAAATTGTTTTCTCAGGT
                      ____________________________________________________________
consensus ACAGTTCCAATTTCACATTTGATATCTTTTATCTAGTGCCTTTAAATTGTTTTCTCAGGT
 
. : . : . : . : . : . :
rJMSF038M04+ TAATGCAGTTTTAGTTTTACTTTAGTTTTTATTTTCTTAGTTTCTTTTGTTATACTGGCA
rJMSF008E22+ TAATGCAGTTTTAGTTTTACTTTAGTTTTTATTTTCTTAGTTTCTTTTGTTATACTGGCA
                      ____________________________________________________________
consensus TAATGCAGTTTTAGTTTTACTTTAGTTTTTATTTTCTTAGTTTCTTTTGTTATACTGGCA
 
. : . : . : . : . : . :
rJMSF038M04+ ACCAAAGCATCCATATTTTGTACTTACGATAATGCAATTTAGGTTAATGA
rJMSF008E22+ ACCAAAGCATCCATATTTTGTACTTA-GATAATGCAATTTAGGTTAATGACGCCGACTGA
                      ____________________________________________________________
consensus ACCAAAGCATCCATATTTTGTACTTACGATAATGCAATTTAGGTTAATGACGCCGACTGA