Previous Contig 011410:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007P12Sequence251005398 (4)745011410 (2)
JMSF034K16Sequence686003008 (2)715011410 (2)gb:AX076881_14606692e-18Sequence 2 from Patent WO0107635.>gb:AX076883_1460670 Sequence 4 from Patent WO0

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034K16+ GATATACTTATCTTCC
                      ____________________________________________________________
consensus GATATACTTATCTTCC
 
. : . : . : . : . : . :
rJMSF034K16+ ATGGAAGGAGATAGACACCAATTGGTGAGTTGTCGCACCTTGAGGCGCTTAAACTAAAAG
                      ____________________________________________________________
consensus ATGGAAGGAGATAGACACCAATTGGTGAGTTGTCGCACCTTGAGGCGCTTAAACTAAAAG
 
. : . : . : . : . : . :
rJMSF034K16+ ATTTTGCCTTCTGTGGTTCAGAGTGGAAACCATCAAAGCTGTGCTTTCGCAAATTAAAGG
                      ____________________________________________________________
consensus ATTTTGCCTTCTGTGGTTCAGAGTGGAAACCATCAAAGCTGTGCTTTCGCAAATTAAAGG
 
. : . : . : . : . : . :
rJMSF034K16+ CACTTCTTATTTCACGTTCAGATCTCAAACATTGGCATGCAAGTTCTAATCATTTCCCAG
                      ____________________________________________________________
consensus CACTTCTTATTTCACGTTCAGATCTCAAACATTGGCATGCAAGTTCTAATCATTTCCCAG
 
. : . : . : . : . : . :
rJMSF034K16+ TTTTGGAGCACCTAGTCTTGAGATATTGTTGGGAATTGGAACAAGTTCCACTGGAGTTTG
rJMSF007P12+ TTTG
                      ____________________________________________________________
consensus TTTTGGAGCACCTAGTCTTGAGATATTGTTGGGAATTGGAACAAGTTCCACTGGAGTTTG
 
. : . : . : . : . : . :
rJMSF034K16+ CAAAAATTGGAACATTGAAGTTAATTGTGTTAGAATGTTGCTATTCTTCTCTTGTGACCT
rJMSF007P12+ CAAATATTGGACCACTGAAGTTGATTGTGTTAGAATGCTGTTATTCTTCTCTTGTGACTT
                      ____________________________________________________________
consensus CAAATATTGGACCATTGAAGTTGATTGTGTTAGAATGTTGTTATTCTTCTCTTGTGACTT
 
. : . : . : . : . : . :
rJMSF034K16+ CTGCAAAGCATATTTCTTCTGCAAAGATGTTATTGTTTAAGGGAACAGCAGTTTGTCCAC
rJMSF007P12+ CTGCAATGCAGATTTCCTCTGCAAAGAAGTTATTGCTTGAGGGAACGACAGATTGTCCAC
                      ____________________________________________________________
consensus CTGCAATGCATATTTCTTCTGCAAAGATGTTATTGTTTGAGGGAACGGCAGTTTGTCCAC
 
. : . : . : . : . : . :
rJMSF034K16+ TTTGTGTTCGTAAAGTTGGAACTAAGGTTGAATTGCCAAATAATGAAAGCTCTGAAGAAG
rJMSF007P12+ TTTATGTTCGTGAAGTTAGAACTAAGCTTGAATTGCCAAATAATGAAAGCTTTGAAGAAG
                      ____________________________________________________________
consensus TTTGTGTTCGTGAAGTTGGAACTAAGGTTGAATTGCCAAATAATGAAAGCTTTGAAGAAG
 
. : . : . : . : . : . :
rJMSF034K16+ AAATTGTGGGAAGCT-TGAAGAAGAAAGTGTGGAAAG
rJMSF007P12+ AAATTGTAGTAAACTCTGAAGAAGAAAATGTGGAAAGTGTGAAAAGCTTTGAAGAAGAAA
                      ____________________________________________________________
consensus AAATTGTGGTAAGCTCTGAAGAAGAAAGTGTGGAAAGTGTGAAAAGCTTTGAAGAAGAAA
 
. : . : . : . : . : . :
rJMSF007P12+ GTGTGAAAAGCTCTGAAGAAGAAAGTGTGAAAAGCTCTGAAGAAGAAAGTGTGGGAAGCT
                      ____________________________________________________________
consensus GTGTGAAAAGCTCTGAAGAAGAAAGTGTGAAAAGCTCTGAAGAAGAAAGTGTGGGAAGCT
 
. : . : . : . : . : . :
rJMSF007P12+ CTAAAGAAGAATTCGTTGGAAGCTCGATGGTTGAATTGCCAAATAATGAAAGCTATGAAG
                      ____________________________________________________________
consensus CTAAAGAAGAATTCGTTGGAAGCTCGATGGTTGAATTGCCAAATAATGAAAGCTATGAAG
 
. : . : . : . : . : . :
rJMSF007P12+ AACAAAGTGTGGAAAGCTCTAAAGAAGAAAGAATGGGAAGGTATAAAGAATTAAGTGTTG
                      ____________________________________________________________
consensus AACAAAGTGTGGAAAGCTCTAAAGAAGAAAGAATGGGAAGGTATAAAGAATTAAGTGTTG
 
. : . : . : . : . : . :
rJMSF007P12+ GAAGCTCTGATCAAGAAAGGTTGAAAGCTCGGAAGAGAGTGATGAAAAATCTGAAGAAGA
                      ____________________________________________________________
consensus GAAGCTCTGATCAAGAAAGGTTGAAAGCTCGGAAGAGAGTGATGAAAAATCTGAAGAAGA
 
. : . : . : . : . : . :
rJMSF007P12+ AGGTGTCGAAATCCCTGAATGCATTCAAAGATTTGAAGGCGAAAGTGTTAAGAAGAAAGT
                      ____________________________________________________________
consensus AGGTGTCGAAATCCCTGAATGCATTCAAAGATTTGAAGGCGAAAGTGTTAAGAAGAAAGT
 
. : . : . : . : . : . :
rJMSF007P12+ GAGTGAGGAATTTTTAAATTTTAGCTTATTATAAACATATGATCCAAAGCCAAGGTATGT
                      ____________________________________________________________
consensus GAGTGAGGAATTTTTAAATTTTAGCTTATTATAAACATATGATCCAAAGCCAAGGTATGT
 
. : . : . : . : . : . :
rJMSF007P12+ ATGTATATACCTATGAAACTATTATGAAACTAATGAGATTATTCTGATCTTTTGCAATTG
                      ____________________________________________________________
consensus ATGTATATACCTATGAAACTATTATGAAACTAATGAGATTATTCTGATCTTTTGCAATTG
 
. : . : . : . : . : . :
rJMSF007P12+ TCTGTCTGTCTCTTTGATTGGGAATTTGTATAACCATGTTGATATTTTGAACAAAGATGT
                      ____________________________________________________________
consensus TCTGTCTGTCTCTTTGATTGGGAATTTGTATAACCATGTTGATATTTTGAACAAAGATGT