Previous Contig 011407:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007P03Sequence292011407 (2)gb:AP003704_18321365e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10755011407 (2)gb:AP003704_18321365e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF007P03- GGTCATCCATTGCAGAAGAAAAGGGAGCTCCAATGC
                      ____________________________________________________________
consensus GGTCATCCATTGCAGAAGAAAAGGGAGCTCCAATGC
 
. : . : . : . : . : . :
JMSF007P03- AGAGTTGAAAACAAGCCAACTACTTTGAAGTTTGAAGCTAAATTATCAGTCGAAGATGTC
                      ____________________________________________________________
consensus AGAGTTGAAAACAAGCCAACTACTTTGAAGTTTGAAGCTAAATTATCAGTCGAAGATGTC
 
. : . : . : . : . : . :
JMSF007P03- TGGTTCCTTCGAGGAGTTCGCTCAATTCGACATCTCCGTCGAGGAAAAGGACAAGCTCGT
                      ____________________________________________________________
consensus TGGTTCCTTCGAGGAGTTCGCTCAATTCGACATCTCCGTCGAGGAAAAGGACAAGCTCGT
 
. : . : . : . : . : . :
JMSF007P03- CGGAGAAGTAATACGCTACGTGTTGTTCAAGACTGAGCAGAGCTCGGGCTGTCCGATAAA
                      ____________________________________________________________
consensus CGGAGAAGTAATACGCTACGTGTTGTTCAAGACTGAGCAGAGCTCGGGCTGTCCGATAAA
 
. : . : . : . : . : . :
JMSF007P03- GAGGGAGGATTTGACTCAGTTGATCACCGGCAAAAACTACCGGCAGAGGAATCTCCCTGC
rJMSF007P03+ ACCGGCAAAAACTACCGGCAGAGGAATCTCCCTGC
                      ____________________________________________________________
consensus GAGGGAGGATTTGACTCAGTTGATCACCGGCAAAAACTACCGGCAGAGGAATCTCCCTGC
 
. : . : . : . : . : . :
JMSF007P03- TTTTGTTATCAATGAG
rJMSF007P03+ TTTTGTTATCAATGAGGCTAGGAAGAAGCTCGAGGAAATCTTCGGTTACGAAATGAAGGA
                      ____________________________________________________________
consensus TTTTGTTATCAATGAGGCTAGGAAGAAGCTCGAGGAAATCTTCGGTTACGAAATGAAGGA
 
. : . : . : . : . : . :
rJMSF007P03+ GCTTCAGCGCGCCCGTTTGTCCACCACCAATCGCTTCTCGCAGCAAGCCACTGCTGATGC
                      ____________________________________________________________
consensus GCTTCAGCGCGCCCGTTTGTCCACCACCAATCGCTTCTCGCAGCAAGCCACTGCTGATGC
 
. : . : . : . : . : . :
rJMSF007P03+ AAAATCATATATTCTCATCAGTAAGTTACCTCCAAAAGCCTACAAGGAGTGTGTGGAGGA
                      ____________________________________________________________
consensus AAAATCATATATTCTCATCAGTAAGTTACCTCCAAAAGCCTACAAGGAGTGTGTGGAGGA
 
. : . : . : . : . : . :
rJMSF007P03+ TAAGAGCAAATCACATGTTACTGGTTTCACATTTGTGGTCATGAGTGTTATTTATCTTGC
                      ____________________________________________________________
consensus TAAGAGCAAATCACATGTTACTGGTTTCACATTTGTGGTCATGAGTGTTATTTATCTTGC
 
. : . : . : . : . : . :
rJMSF007P03+ CGGAGGCAATATAACAGAGGAAGATCTTTGGCGTCATTTGAGACGGTTGGGTCTGATGCA
                      ____________________________________________________________
consensus CGGAGGCAATATAACAGAGGAAGATCTTTGGCGTCATTTGAGACGGTTGGGTCTGATGCA
 
. : . : . : . : . : . :
rJMSF007P03+ AACTGATGAAAGCCATCCTGTCCTTGGTAACCTCAAACTGGCATTGGAGGCGCTTGTTCA
                      ____________________________________________________________
consensus AACTGATGAAAGCCATCCTGTCCTTGGTAACCTCAAACTGGCATTGGAGGCGCTTGTTCA
 
. : . : . : . : . : . :
rJMSF007P03+ GCAAAGATATGTGCATAAAGAGAAAGTCAGTGGTCCTGAAGGAAATGTTATACATTATGA
                      ____________________________________________________________
consensus GCAAAGATATGTGCATAAAGAGAAAGTCAGTGGTCCTGAAGGAAATGTTATACATTATGA
 
. : . : . : . : . : . :
rJMSF007P03+ GCTTGCTGAGAGAGCTCTAGATGAGGATATTAATAATAGAATGAAAGAGTATATATCCAA
                      ____________________________________________________________
consensus GCTTGCTGAGAGAGCTCTAGATGAGGATATTAATAATAGAATGAAAGAGTATATATCCAA
 
. : . : . : . : . : . :
rJMSF007P03+ GATTGTGCAAAAGGATATTAACACAGTGGATGTTGATTAGCTATTTCTGCTGGCTGGAAC
                      ____________________________________________________________
consensus GATTGTGCAAAAGGATATTAACACAGTGGATGTTGATTAGCTATTTCTGCTGGCTGGAAC
 
. : . : . : . : . : . :
rJMSF007P03+ GTGCGTTTGGAAATTACTAGTGTTTTTGATAAGTGATCTAGGAAGAATGTAGCACAGTGG
                      ____________________________________________________________
consensus GTGCGTTTGGAAATTACTAGTGTTTTTGATAAGTGATCTAGGAAGAATGTAGCACAGTGG
 
. : . : . : . : . : . :
rJMSF007P03+ ATGTATTTTTGTGTTTCTATTACTCTTCGAGGAAAGGATGTCCTGTGCGGTGCCATTTTG
                      ____________________________________________________________
consensus ATGTATTTTTGTGTTTCTATTACTCTTCGAGGAAAGGATGTCCTGTGCGGTGCCATTTTG
 
. : . : . : . : . : . :
rJMSF007P03+ TTTCCTCTTTTGCTGTAAATTTCTACTGTGTTGCCAAAGTGTTTAGTTTTGTGAAATTCC
                      ____________________________________________________________
consensus TTTCCTCTTTTGCTGTAAATTTCTACTGTGTTGCCAAAGTGTTTAGTTTTGTGAAATTCC