Previous Contig 011406:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN028A12Sequence639011406 (7)gb:AY607764_16175452e-54Populus alba x Populus tremula fasciclin-like AGP 12 (FLA12) mRNA, complete cds.
JMSF007O21Sequence242011406 (7)683011406 (7)gb:AY607764_16175455e-39Populus alba x Populus tremula fasciclin-like AGP 12 (FLA12) mRNA, complete cds.
JMSF008O21Sequence680011406 (7)gb:AY607764_16175451e-38Populus alba x Populus tremula fasciclin-like AGP 12 (FLA12) mRNA, complete cds.
JMSF010E05Sequence419011406 (7)gb:AY607764_16175457e-20Populus alba x Populus tremula fasciclin-like AGP 12 (FLA12) mRNA, complete cds.
JMSF025B15Sequence554019375767011406 (7)gb:AY607764_16175452e-60Populus alba x Populus tremula fasciclin-like AGP 12 (FLA12) mRNA, complete cds.
JMSF037E17Sequence528019936765011406 (7)gb:AY607764_16175452e-65Populus alba x Populus tremula fasciclin-like AGP 12 (FLA12) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF007O21- CTCCAAACCCCTCTCCCCTCTCTCTCTCTCTCTCTCTCTGAG
JMSF010E05- GGTCTTCCACCTCCAAACCCCTCTCCCCTCTCTCTCTCTCTCTCTCTCTGAG
JMFN028A12- CCCTCTCTCTCTCTCTCTCTCTCTGAG
                      ____________________________________________________________
consensus GGTCTTCCACCTCCAAACCCCTCTCCCCTCTCTCTCTCTCTCTCTCTCTGAG
 
. : . : . : . : . : . :
JMSF007O21- TTGCTCAACTCAGCTCAGTTCTCCCCAGGGACTCTAGTCTCTAGTGTTTATTCCAGGGAG
JMSF010E05- TTGCTCAACTCAGCTCAGTTCTCCCCAGGGACTCTAGTCTCTAGTGTTTATTCCAGGGAG
JMFN028A12- TTGCTCAACTCAGCTCAGTTCTCCCCAGGGACTCTAGTCTCTAGTGTTTATTCCAGGGAG
                      ____________________________________________________________
consensus TTGCTCAACTCAGCTCAGTTCTCCCCAGGGACTCTAGTCTCTAGTGTTTATTCCAGGGAG
 
. : . : . : . : . : . :
JMSF007O21- AGAGAGAGAAGCACATTATCATACCTGTAAGATGGATTACACTTTTGTGTTTGTGATTGC
JMSF010E05- AGAGAGAGAAGCACATTATCATACCTGTAAGATGGATTACACTTTTGTGTTTGTGATTGC
JMFN028A12- AGAGAGAGAAGCACATTATCATACCTGTAAGATGGATTACACTTTTGTGTTTGTGATTGC
                      ____________________________________________________________
consensus AGAGAGAGAAGCACATTATCATACCTGTAAGATGGATTACACTTTTGTGTTTGTGATTGC
 
. : . : . : . : . : . :
JMSF007O21- TAGTCTGATGATCTTTTCTTGCTCGATGCCGGCAGTGAATGCCCAAAGCATTTCTCTGTC
JMSF010E05- TAGTCNGATGATCTTTTCTTGCTCGATGCCGGCAGTGAATGCCCAAAGCATTTCTCTGTC
JMFN028A12- TAGTCTGATGATCTTTTCTTGCTCGATGCCGGCAGTGAATGCCCAAAGCATTTCTCTGTC
                      ____________________________________________________________
consensus TAGTCTGATGATCTTTTCTTGCTCGATGCCGGCAGTGAATGCCCAAAGCATTTCTCTGTC
 
. : . : . : . : . : . :
JMSF007O21- TCCGGCACCAGCCCCGG
JMSF010E05- TCCGGCACCAGCCCCGGCCCCAGACTTTGTGAACCTAACAGATTTGCTATCTGTTGNTGG
JMFN028A12- TCCGGCACCAGCCCCGGCCCCAGACTTTGTGAACCTAACAGATTTGCTATCTGTTGCTGG
rJMSF037E17+ TCCGGCACCAGGCCCGGCCCCAGACTTTGTGAACCTAACAGATTTGCTATCTGTTGCTGG
rJMSF025B15+ CAGACTTTGTGAACCTAACAGATTTGCTATCTGTTGCTGG
                      ____________________________________________________________
consensus TCCGGCACCAGCCCCGGCCCCAGACTTTGTGAACCTAACAGATTTGCTATCTGTTGCTGG
 
. : . : . : . : . : . :
JMSF010E05- ACCTTTCCACACTTTCCTTAACTACATTGAGACCACCAAAGNTGTGGAAACTTTCCAAAA
JMFN028A12- ACCTTTCCACACTTTCCTTAACTACATTGAGACCACCAAAGTTGTGGAAACTTTCCAAAA
rJMSF037E17+ ACCTTTCCACACTTTCCTTAACTACATTGAGACCACCAAAGTTGTGGAAACTTTCCAAAA
rJMSF025B15+ ACCTTTCCACACTTTCCTTAACTACATTGAGACCACCAAAGTTGTGGAAACTTTCCAAAA
                      ____________________________________________________________
consensus ACCTTTCCACACTTTCCTTAACTACATTGAGACCACCAAAGTTGTGGAAACTTTCCAAAA
 
. : . : . : . : . : . :
JMSF010E05- CCAAGCCAACGATACTAAAGAAGGGCTTACTCTCTTCGTGCCCAAAGACGATGCCTTCTC
JMFN028A12- CCAAGCCAACGATACTAAAGAAGGGCTTACTCTCTTCGTGCCCAAAGACGATGCCTTCTC
rJMSF037E17+ CCAAGCCAACGATACTAAAGAAGGGCTTACTCTCTTCGTGCCCAAAGACGATGCCTTCTC
rJMSF025B15+ CCAAGCCAACGATACTAAAGAAGGGCTTACTCTCTTCGTGCCCAAAGACGATGCCTTCTC
rJMSF008O21+ CCCAAAGACGATGCCTTCTC
rJMSF007O21+ GTGCCCAAAGACGATGCCTTCTC
                      ____________________________________________________________
consensus CCAAGCCAACGATACTAAAGAAGGGCTTACTCTCTTCGTGCCCAAAGACGATGCCTTCTC
 
. : . : . : . : . : . :
JMSF010E05- CAAGAAA
JMFN028A12- CAAGAAAACGAAGCAGGCACTCTCGAATCTCACCGCTGACCAGCTCAAATCTGTGTTCCT
rJMSF037E17+ CAAGAAAACGAAGCAGGCACTCTCGAATCTCACCGCTGACCAGCTCAAATCTGTGTTCCT
rJMSF025B15+ CAAGAAAACGAAGCAGGCACTCTCGAATCTCACCGCTGACCAGCTCAAATCTGTGTTCCT
rJMSF008O21+ CAAGAAAACGAAGCAGGCACTCTCGAATCTCACCGCTGACCAGCTCAAATCTGTGTTCCT
rJMSF007O21+ CAAGAAAACGAAGCAGGCACTCTCGAATCTCACCGCTGACCAGCTCAAATCTGTGTTCCT
                      ____________________________________________________________
consensus CAAGAAAACGAAGCAGGCACTCTCGAATCTCACCGCTGACCAGCTCAAATCTGTGTTCCT
 
. : . : . : . : . : . :
JMFN028A12- TTACCACGCATTGCCACATTACTACTCGCTCTCCGACTTAAGAAACCTCAGCCAAGTTGG
rJMSF037E17+ TTACCACGCATTGCCACATTACTACTCGCTCTCCGACTTAAGAAACCTCAGCCAAGTTGG
rJMSF025B15+ TTACCACGCATTGCCACATTACTACTCGCTCTCCGACTTAAGAAACCTCAGCCAAGTTGG
rJMSF008O21+ TTACCACGCATTGCCACATTACTACTCGCTCTCCGACTTAAGAAACCTCAGCCAAGTTGG
rJMSF007O21+ TTACCACGCATTGCCACATTACTACTCGCTCTCCGACTTAAGAAACCTCAGCCAAGTTGG
                      ____________________________________________________________
consensus TTACCACGCATTGCCACATTACTACTCGCTCTCCGACTTAAGAAACCTCAGCCAAGTTGG
 
. : . : . : . : . : . :
JMFN028A12- TCCGATCAGTACCTTTGCCGGTGGGCAACTTAGTGCCCTGAATTTCACTGATGTGTCTGG
rJMSF037E17+ TCCGATCAGTACCTTTGCCGGTGGGCAACTTAGTGCCCTGAATTTCACTGATGTGTCTGG
rJMSF025B15+ TCCGATCAGTACCTTTGCCGGTGGGCAACTTAGTGCCCTGAATTTCACTGATGTGTCTGG
rJMSF008O21+ TCCGATCAGTACCTTTGCCGGTGGGCAACTTAGTGCCCTGAATTTCACTGATGTGTCTGG
rJMSF007O21+ TCCGATCAGTACCTTTGCCGGTGGGCAACTTAGTGCCCTGAATTTCACTGATGTGTCTGG
                      ____________________________________________________________
consensus TCCGATCAGTACCTTTGCCGGTGGGCAACTTAGTGCCCTGAATTTCACTGATGTGTCTGG
 
. : . : . : . : . : . :
JMFN028A12- GACTGTGCACCTGAACTCGGGATGGACCAGTACCAAAATTAGCAGTGCAGTTCATGCAAC
rJMSF037E17+ GACTGTGCACCTGAACTCGGGATGGACCAGTACCAAAATTAGCAGTGCAGTTCATGCAAC
rJMSF025B15+ GACTGTGCACCTGAACTCGGGATGGACCAGTACCAAAATTAGCAGTGCAGTTCATGCAAC
rJMSF008O21+ GACTGTGCACCTGAACTCGGGATGGACCAGTACCAAAATTAGCAGTGCAGTTCATGCAAC
rJMSF007O21+ GACTGTGCACCTGAACTCGGGATGGACCAGTACCAAAATTAGCAGTGCAGTTCATGCAAC
                      ____________________________________________________________
consensus GACTGTGCACCTGAACTCGGGATGGACCAGTACCAAAATTAGCAGTGCAGTTCATGCAAC
 
. : . : . : . : . : . :
JMFN028A12- TTACCCCGTTGC
rJMSF037E17+ TTACCCCGTTGCCATTTATCAGGTCGACAAAGTTCTCCTCCCCGAAGCCATCTTCGGGAC
rJMSF025B15+ TTACCCCGTTGCCATTTATCAGGTCGACAAAGTTCTCCTCCCCGAAGCCATCTTCGGGAC
rJMSF008O21+ TTACCCCGTTGCCATTTATCAGGTCGACAAAGTTCTCCTCCCCGAAGCCATCTTCGGGAC
rJMSF007O21+ TTACCCCGTTGCCATTTATCAGGTCGACAAAGTTCTCCTCCCCGAAGCCATCTTCGGGAC
                      ____________________________________________________________
consensus TTACCCCGTTGCCATTTATCAGGTCGACAAAGTTCTCCTCCCCGAAGCCATCTTCGGGAC
 
. : . : . : . : . : . :
rJMSF037E17+ AGATATCCCCCCCACCCCTGCACCCGCACCATCTCCAGACATTGCCCCGGCTGCAGATGC
rJMSF025B15+ AGATATCCCCCCCACCCCTGCACCCGCACCATCTCCAGACATTGCCCCGGCTGCAGATGC
rJMSF008O21+ AGATATCCCCCCCACCCCTGCACCCGCACCATCTCCAGACATTGCCCCGGCTGCAGATGC
rJMSF007O21+ AGATATCCCCCCCACCCCTGCACCCGCACCATCTCCAGACATTGCCCCGGCTGCAGATGC
                      ____________________________________________________________
consensus AGATATCCCCCCCACCCCTGCACCCGCACCATCTCCAGACATTGCCCCGGCTGCAGATGC
 
. : . : . : . : . : . :
rJMSF037E17+ TCCAGCTTCTGACAAAGCCATCAGTGGCGACTCAACGTCTCCAACTTCTTCACCTCCATC
rJMSF025B15+ TCCAGCTTCTGACAAAGGCATCAGTGGCGACTCAACGTCTCCAACTTCTTCACCTCCATC
rJMSF008O21+ TCCAGCTTCTGACAAAGGCATCAGTGGCGACTCAACGTCTCCAACTTCTTCACCTCCATC
rJMSF007O21+ TCCAGCTTCTGACAAAGGCATCAGTGGCGACTCAACGTCTCCAACTTCTTCACCTCCATC
                      ____________________________________________________________
consensus TCCAGCTTCTGACAAAGGCATCAGTGGCGACTCAACGTCTCCAACTTCTTCACCTCCATC
 
. : . : . : . : . : . :
rJMSF037E17+ GTCTTCCCACAAGATTATGAGCTCGAGTCCTCTCAATCTGATCTTGGCAATCGTGGGTGG
rJMSF025B15+ GTCTTCCCACAAGATTATGAGCTCGAGTCCTCTCAATCTGATCTTGGCAATCGTGGGTGG
rJMSF008O21+ GTCTTCCCACAAGATTATGAGCTCGAGTCCTCTCAATCTGATCTTGGCAATCGTGGGTGG
rJMSF007O21+ GTCTTCCCACAAGATTATGAGCTCGAGTCCTCTCAATCTGATCTTGGCAATCGTGGGTGG
                      ____________________________________________________________
consensus GTCTTCCCACAAGATTATGAGCTCGAGTCCTCTCAATCTGATCTTGGCAATCGTGGGTGG
 
. : . : . : . : . : . :
rJMSF037E17+ ATCTGCTGCCTTCTTCCTGTAAACTTTTGTCACACATTGAATTAAATTAATTTATGCTTT
rJMSF025B15+ ATCTGCTGCCTTCTTCCTGTAAACTTTTGTCACACATTGAATTAAATTAATTTATGCTTT
rJMSF008O21+ ATCTGCTGCCTTCTTCCTGTAAACTTTTGTCACACATTGAATTAAATTAATTTATGCTTT
rJMSF007O21+ ATCTGCTGCCTTCTTCCTGTAAACTTTTGTCACACATTGAATTAAATTAATTTATGCTTT
                      ____________________________________________________________
consensus ATCTGCTGCCTTCTTCCTGTAAACTTTTGTCACACATTGAATTAAATTAATTTATGCTTT
 
. : . : . : . : . : . :
rJMSF037E17+ TGTAAGAGGATATACCCCATTCAGATTGGTTCACTTGTTCCCCAT
rJMSF025B15+ TGTAAGAGGATATACCCCATTCAGATTGGTTCACTTGTTCCCCATTTTTTCTGTCATATA
rJMSF008O21+ TGTAAGAGGATATACCCCATTCAGATTGGTTCACTTGTTCCCCATTTTTTCTGTCATATA
rJMSF007O21+ TGTAAGAGGATATACCCCATTCAGATTGGTTCACTTGTTCCCCATTTTTTCTGTCATATA
                      ____________________________________________________________
consensus TGTAAGAGGATATACCCCATTCAGATTGGTTCACTTGTTCCCCATTTTTTCTGTCATATA
 
. : . : . : . : . : . :
rJMSF025B15+ CAATATA
rJMSF008O21+ CAATATACTGGTCCTTCCATTTGGTGAGAATTGTATTGTATTATTCAGGTCGCTTCATTG
rJMSF007O21+ CAATATACTGGTCCTTCCATTTGGTGAGAATTGTATTGTATTATTCAGGTCGCTTCATTG
                      ____________________________________________________________
consensus CAATATACTGGTCCTTCCATTTGGTGAGAATTGTATTGTATTATTCAGGTCGCTTCATTG