Previous Contig 011405:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN035K21Sequence606011405 (3)gb:OSJN00033_16936271e-47Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0042L16, complete seque
JMSF007O06Sequence307007182 (5)gb:AF435646_17998391e-05Oryza sativa CSLH1 mRNA, partial cds.769011405 (3)gb:OSJN00033_16936275e-51Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0042L16, complete seque
JMSF037O06Sequence635007182 (5)pir|T02553|T025531e-46cellulose synthase homolog T26B15.10 - Arabidopsis thaliana>gb:AC004681_1532027 687011405 (3)gb:OSJN00033_16936275e-43Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0042L16, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007O06+ CTGGGGTAATGGAAATACTTATCAGCAAGAAAAGCCCAATAATTTTGGC
                      ____________________________________________________________
consensus CTGGGGTAATGGAAATACTTATCAGCAAGAAAAGCCCAATAATTTTGGC
 
. : . : . : . : . : . :
JMFN035K21- GGGCGGCTCCAGTTGAGGCAATGCCTAGCATATCTATGGGTTATGTGTTGGCC
rJMSF037O06+ AGGCAATGCTTGGCCTATCTATGGATTATGGGTTGGCC
rJMSF007O06+ CCTATTTGGGCGGCTCCAGTTGAGGCAATGCCTAGCATATCTATGGGTTATGTGTTGGCC
                      ____________________________________________________________
consensus CCTATTTGGGCGGCTCCAGTTGAGGCAATGCCTAGCATATCTATGGGTTATGTGTTGGCC
 
. : . : . : . : . : . :
JMFN035K21- CATTCGGCCCATTTTTGAAACATGTTATTCTCTTCTCCCCGCGTATTGCATCATCAACAA
rJMSF037O06+ CATTCGGCCCTTTTTTGAAATATGTTATTCTCTTCTCCCCGCGTATTGCATCATCAACAA
rJMSF007O06+ CATTCGGCCCATTTTTGAAACATGTTATTCTCTTCTCCCCGCGTATTGCATCATCAACAA
                      ____________________________________________________________
consensus CATTCGGCCCATTTTTGAAACATGTTATTCTCTTCTCCCCGCGTATTGCATCATCAACAA
 
. : . : . : . : . : . :
JMFN035K21- TTCCCACTTCCAACCAAAGCTAAACGAAGCCGCCATTGTAATACCAGCTTCCATTTTCCT
rJMSF037O06+ TTCTCACTTCCAACCAAAGCTAAACGAAGCCGCCATTGTAATACCAGCTTCCATTTTCAT
rJMSF007O06+ TTCCCACTTCCAACCAAAGCTAAACGAAGCCGCCATTGTAATACCAGCTTCCATTTTCCT
                      ____________________________________________________________
consensus TTCCCACTTCCAACCAAAGCTAAACGAAGCCGCCATTGTAATACCAGCTTCCATTTTCCT
 
. : . : . : . : . : . :
JMFN035K21- CATCTACAACTTGTACAATCTATCGGAGTACATTAGAACCGGGGAGTCGTTGCGGGCGTG
rJMSF037O06+ TATCTACAACTTGTACGGTCTATTCAAATACATCGAAACCGGGGAGTCGTTGCGGGCGTG
rJMSF007O06+ CATCTACAACTTGTACAATCTATCGGAGTACATCAGAACCGGGGAGTCGTTGCGGGCGTG
                      ____________________________________________________________
consensus CATCTACAACTTGTACAATCTATCGGAGTACATCAGAACCGGGGAGTCGTTGCGGGCGTG
 
. : . : . : . : . : . :
JMFN035K21- GTGGAACAACCAAAGAATGTGGAGAGTGTACGCATCTGGGTCGTGGTTGTTCGGATTCCT
rJMSF037O06+ GTGGAACAACCAAAGAATGTTGAGAGTTTACGCATCTGGGTCATGGTTGTTCGGATTCCT
rJMSF007O06+ GTGGAACAACCAAAGAATGTGGAGAGTGTACGCATCTGGGTCGTGGTTGTTCGGATTCCT
                      ____________________________________________________________
consensus GTGGAACAACCAAAGAATGTGGAGAGTGTACGCATCTGGGTCGTGGTTGTTCGGATTCCT
 
. : . : . : . : . : . :
JMFN035K21- AAGCGGGGTTGTTAAGGTTTTTGGATTGTCGGAAACGGTGTTCGAAGTCACCAAGAAAGA
rJMSF037O06+ AAGTGGGGTTGTTAAGGTTTTTGGATTGTCTGAAGCGGTGTTCGAAGTCACCAAGAAAGA
rJMSF007O06+ AAGCGGGGTTGTTAAGGTTTTTGGATTGTCGGAAACGGTGTTCGAAGTCACCAAGAAAGA
                      ____________________________________________________________
consensus AAGCGGGGTTGTTAAGGTTTTTGGATTGTCGGAAACGGTGTTCGAAGTCACCAAGAAAGA
 
. : . : . : . : . : . :
JMFN035K21- TCATTCGAGCGACGAAACTCTAGACAAGGATGACGACTCCAACGTCGGACGGTTCACATT
rJMSF037O06+ TCATTCGAGCGACGAAGCTCTAGACAAGGATGATGACTCCAAGGTCGGACGGTTCACGTT
rJMSF007O06+ TCATTCGAGCGACGAAACTCTAGACAAGGATGACGACTCCAACGTCGGACGGTTCACATT
                      ____________________________________________________________
consensus TCATTCGAGCGACGAAACTCTAGACAAGGATGACGACTCCAACGTCGGACGGTTCACATT
 
. : . : . : . : . : . :
JMFN035K21- CAATGAATCTCCGCTGTTTGTCCCTGGCACAACCATTTTGCTGGTGAACTTGGCAGCTTT
rJMSF037O06+ TGATGAATCTCCGTTGTTTGTCCCCGGCACAACCATTTTGCTGGTGAACTTGGCAGCTTT
rJMSF007O06+ CAATGAATCTCCGCTGTTTGTCCCTGGCACAACCATTTTGCTGGTGAACTTGGCAGCTTT
                      ____________________________________________________________
consensus CAATGAATCTCCGCTGTTTGTCCCTGGCACAACCATTTTGCTGGTGAACTTGGCAGCTTT
 
. : . : . : . : . : . :
JMFN035K21- GTTCATTGGATTTCTGGATTTTAAACAGAATAAGAGTTGGAGTTTTGGAGAGGTAATATG
rJMSF037O06+ GTTTATTGGATTTCTGGATTTTAAACAGAATAAGAGTTGGAGTTTAGGAGAAGCAATATG
rJMSF007O06+ GTTCATTGGATTTCTGGATTTTAAACAGAATAAGAGTTGGAGTTTTGGAGAGGTAATATG
                      ____________________________________________________________
consensus GTTCATTGGATTTCTGGATTTTAAACAGAATAAGAGTTGGAGTTTTGGAGAGGTAATATG
 
. : . : . : . : . : . :
JMFN035K21- CAGTGTGTGGGTAATATTAATGTATTGGGCATTTCTTAAGGGGCTTGTTGGAAAGGGGAA
rJMSF037O06+ CAGTGTTTGGGTAATATTAATGTATTGGGCGTTTCTTAAGGGGTTGTTTGGAAAGGGAAA
rJMSF007O06+ CAGTGTGTGGGTAATATTAATGTATTGGGCATTTCTTAAGGGGTTGTTTGGAAAGGGGAA
                      ____________________________________________________________
consensus CAGTGTGTGGGTAATATTAATGTATTGGGCATTTCTTAAGGGGTTGTTTGGAAAGGGGAA
 
. : . : . : . : . : . :
JMFN035K21- GTATGGGATTCCA
rJMSF037O06+ GTTTGGGATTCCATTGTC
rJMSF007O06+ GTATGGGATTCCATTGTCTATTATTGTAAAGTCTGTGGGATTGGCATTGCTTTTTGTCCA
                      ____________________________________________________________
consensus GTATGGGATTCCATTGTCTATTATTGTAAAGTCTGTGGGATTGGCATTGCTTTTTGTCCA
 
. : . : . : . : . : . :
rJMSF007O06+ TGTCTGCAAAAGGGTATACTGATCCTACTTCTGAGCAATATAGGTATCAAGTTATCAGTA
                      ____________________________________________________________
consensus TGTCTGCAAAAGGGTATACTGATCCTACTTCTGAGCAATATAGGTATCAAGTTATCAGTA