Previous Contig 011400:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS111B01Sequence642011400 (3)pir|H86240|H862402e-73hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890087 Arabid
JMSF007M11Sequence297004922 (3)764011400 (3)pir|H86240|H862404e-31hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890087 Arabid
JMSF023M10Sequence623004922 (3)pir|H86240|H862409e-16hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890087 Arabid758011400 (3)pir|H86240|H86240e-107hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890087 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023M10+ TGACATACCCTGGCTGAAGGCATACTATAAT
                      ____________________________________________________________
consensus TGACATACCCTGGCTGAAGGCATACTATAAT
 
. : . : . : . : . : . :
rJMSF023M10+ TTTGGGTTTGATCATTTCAACATCTCCTGGAAGAAAAGTGGCATTTGGGGTCTTGTTGAT
                      ____________________________________________________________
consensus TTTGGGTTTGATCATTTCAACATCTCCTGGAAGAAAAGTGGCATTTGGGGTCTTGTTGAT
 
. : . : . : . : . : . :
rJMSF023M10+ TGCCTTATGGGAAATGCCGGTCCATTTGCTTCCGGGGACTGGATACTTCCTGACCTCACT
JMFS111B01- CTGGATACTTCCTGACCTCACT
                      ____________________________________________________________
consensus TGCCTTATGGGAAATGCCGGTCCATTTGCTTCCGGGGACTGGATACTTCCTGACCTCACT
 
. : . : . : . : . : . :
rJMSF023M10+ ATCCAGGGTGCTATCAAGGTGAACAGCCACTTACGTACATTTCCTAACACGTACTACTTC
JMFS111B01- ATCCAGGGTGCTATCAAGGTGAACAGCCACTTACGTACATTTCCTAACACGTACTACTTC
                      ____________________________________________________________
consensus ATCCAGGGTGCTATCAAGGTGAACAGCCACTTACGTACATTTCCTAACACGTACTACTTC
 
. : . : . : . : . : . :
rJMSF023M10+ AGCTATGCCACAAAGCGCACGAGGAAAATTATGGGTGTTACAGTACCTTCCGGCATACTT
JMFS111B01- AGCTATGCCACAAAGCGCACGAGGAAAATTATGGGTGTTACAGTACCTTCCGGCATACTT
                      ____________________________________________________________
consensus AGCTATGCCACAAAGCGCACGAGGAAAATTATGGGTGTTACAGTACCTTCCGGCATACTT
 
. : . : . : . : . : . :
rJMSF023M10+ GGAATACATCCTCTACTGTTTATCAGAGTACTGCAAATGAGCCTATGGCGACACCCTACT
JMFS111B01- GGAATACATCCTCTACTGTTTATCAGAGTACTGCAAATGAGCCTATGGCGACACCCTACT
                      ____________________________________________________________
consensus GGAATACATCCTCTACTGTTTATCAGAGTACTGCAAATGAGCCTATGGCGACACCCTACT
 
. : . : . : . : . : . :
rJMSF023M10+ GATGTCTCGCCCCCTTACAAAGGCTACAGGGATGAGGACTGGTGGGAAAATGATGGAGCA
JMFS111B01- GATGTCTCGCCCCCTTACAAAGGCTACAGGGATGAGGACTGGTGGGAAAATGATGGAGCA
                      ____________________________________________________________
consensus GATGTCTCGCCCCCTTACAAAGGCTACAGGGATGAGGACTGGTGGGAAAATGATGGAGCA
 
. : . : . : . : . : . :
rJMSF023M10+ CTCAACACTATCTCCATGACTCACCCTCGTTTGCCCGTTGAACACCCAAGTCAGCATGTT
JMFS111B01- CTCAACACTATCTCCATGACTCACCCTCGTTTGCCCGTTGAACACCCAAGTCAGCATGTT
rJMSF007M11+ TGACTCACCCTCGTTTGCCCGTTGAACACCCAAGTCAGCATGTT
                      ____________________________________________________________
consensus CTCAACACTATCTCCATGACTCACCCTCGTTTGCCCGTTGAACACCCAAGTCAGCATGTT
 
. : . : . : . : . : . :
rJMSF023M10+ GTAAAGGATTCTGACTGCCAACCACTGCAACCAGGGATCTGGTATTATAAGATTGTGGAA
JMFS111B01- GTAAAGGATTCTGACTGCCAACCACTGCAACCAGGGATCTGGATTTATAA-TGAAAAGAA
rJMSF007M11+ GTAAAGGATTCTGACTGCCAACCACTGCAACCAGGGATCTGGTATTATAAGATTGTGGAA
                      ____________________________________________________________
consensus GTAAAGGATTCTGACTGCCAACCACTGCAACCAGGGATCTGGTATTATAAGATTGTGGAA
 
. : . : . : . : . : . :
rJMSF023M10+ GGTGATCACATTCTTTTCATTATAAATCGGGAAAGGGCCGGAGTCCAATTTGATTTGATA
JMFS111B01- TGTGATCACATTCTTTTCATTATAAATCGGGAAAGGGCCGGAGTCCAATTTGATTTGATA
rJMSF007M11+ GGTGATCACATTCTTTTCATTATAAATCGGGAAAGGGCCGGAGTCCAATTTGATTTGATA
                      ____________________________________________________________
consensus GGTGATCACATTCTTTTCATTATAAATCGGGAAAGGGCCGGAGTCCAATTTGATTTGATA
 
. : . : . : . : . : . :
rJMSF023M10+ TACGATGGCATATTCGAGCGCTGCAGGAAGCATGTCTTTAGGAAACTACCAACATTACCC
JMFS111B01- TACGATGGCATATTCGAGCGCTGCAGGAAGCATGTCTTTAGGAAACTACCAACATTACCC
rJMSF007M11+ TACGATGGCATATTCGAGCGCTGCAGGAAGCATGTCTTTAGGAAACTACCAACATTACCC
                      ____________________________________________________________
consensus TACGATGGCATATTCGAGCGCTGCAGGAAGCATGTCTTTAGGAAACTACCAACATTACCC
 
. : . : . : . : . : . :
rJMSF023M10+ GATAAGTGACTCTGATCTCTAGGTATCACGACGTTTCTCTAGCAATACACGACAAAGTTG
JMFS111B01- GATAAGTGACTCTGATCTCTAGGTATCACGACGTTTCTCTAGCAATACACGACANAGTTG
rJMSF007M11+ GATAAGTGACTCTGATCTCTAGGTATCACGACGTTTCTCTAGCAATACACGACAAAGTTG
                      ____________________________________________________________
consensus GATAAGTGACTCTGATCTCTAGGTATCACGACGTTTCTCTAGCAATACACGACAAAGTTG
 
. : . : . : . : . : . :
rJMSF023M10+ AAGAAATAGGAGAATCTAGACATCATAAGCTGTAGTAGTATTGTACTAAAATTCTTTATT
JMFS111B01- AAGAAATAGGAGAATCTAGACATCATAAGCTGTAGTAGTATTGTACTAAAATTCTTTATT
rJMSF007M11+ AAGAAATAGGAGAATCTAGACATCATAAGCTGTAGTAGTATTGTACTAAAATTCTTTATT
                      ____________________________________________________________
consensus AAGAAATAGGAGAATCTAGACATCATAAGCTGTAGTAGTATTGTACTAAAATTCTTTATT
 
. : . : . : . : . : . :
rJMSF023M10+ CTTCTCT
JMFS111B01- CTTCTCTTTTTCTGCCCTCTT
rJMSF007M11+ CTTCTCTTTTTCTGCCCTCTTTTAATCTAGGAAGAAGAATACTATCGTTTCCCCATTGTG
                      ____________________________________________________________
consensus CTTCTCTTTTTCTGCCCTCTTTTAATCTAGGAAGAAGAATACTATCGTTTCCCCATTGTG
 
. : . : . : . : . : . :
rJMSF007M11+ CATCTTTGTCGTTCCCCGTATATTTCCTGCGTGTATTCTGATCAGGCATCGCCCCCGCCC
                      ____________________________________________________________
consensus CATCTTTGTCGTTCCCCGTATATTTCCTGCGTGTATTCTGATCAGGCATCGCCCCCGCCC
 
. : . : . : . : . : . :
rJMSF007M11+ AAGTTTGTATGTAGGAAAGGGAAAACGCCACTCCAGTAGACTCAGCAAAGGCAATGTGTT
                      ____________________________________________________________
consensus AAGTTTGTATGTAGGAAAGGGAAAACGCCACTCCAGTAGACTCAGCAAAGGCAATGTGTT
 
. : . : . : . : . : . :
rJMSF007M11+ GTTTGGAATTGTGTTGGAAGAATAGTTTCCTGCAACTGAGTTGAAGGAATGTGGTTAGTT
                      ____________________________________________________________
consensus GTTTGGAATTGTGTTGGAAGAATAGTTTCCTGCAACTGAGTTGAAGGAATGTGGTTAGTT
 
. : . : . : . : . : . :
rJMSF007M11+ TGGTGTTTGGAAGCCATTGTTGAGGGAAATATCCATTGTTGATTCTTGTGGTTGGGAGGG
                      ____________________________________________________________
consensus TGGTGTTTGGAAGCCATTGTTGAGGGAAATATCCATTGTTGATTCTTGTGGTTGGGAGGG
 
. : . : . : . : . : . :
rJMSF007M11+ GACTAAAAGTTAAAAAATTAATTATATTCTTTTTGGTTCAGTTTTAGGCAGTTGTAGATG
                      ____________________________________________________________
consensus GACTAAAAGTTAAAAAATTAATTATATTCTTTTTGGTTCAGTTTTAGGCAGTTGTAGATG
 
. : . : . : . : . : . :
rJMSF007M11+ AGATGAGCAATTGTATGGGTCATCCCATTTCCTACACTTTACTGTCTTCACTCAAAGGAT
                      ____________________________________________________________
consensus AGATGAGCAATTGTATGGGTCATCCCATTTCCTACACTTTACTGTCTTCACTCAAAGGAT