Previous Contig 011397:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007M01Sequence340004917 (2)721011397 (2)gb:AY085062_15701446e-75Arabidopsis thaliana clone 126051 mRNA, complete sequence.
JMSF021I24Sequence659004917 (2)gb:AY085062_15701441e-07Arabidopsis thaliana clone 126051 mRNA, complete sequence.781011397 (2)gb:AY085062_15701443e-75Arabidopsis thaliana clone 126051 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021I24+ GGAGGAGTTTGTGGAC
                      ____________________________________________________________
consensus GGAGGAGTTTGTGGAC
 
. : . : . : . : . : . :
rJMSF021I24+ AAGGACGAGTCATTGAGTCAAGAAGATTCGGTTGATGGAGTTGGGTCTTCGCTTCTCTCT
rJMSF007M01+ TCT
                      ____________________________________________________________
consensus AAGGACGAGTCATTGAGTCAAGAAGATTCGGTTGATGGAGTTGGGTCTTCGCTTCTCTCT
 
. : . : . : . : . : . :
rJMSF021I24+ GGGTCACTTTCAATGGCTCTCTGCTATATACAAAGGGTGTTTCGTTCAGGGCCACTCCAT
rJMSF007M01+ GGGTCACTTTCTATGGCTCTCTGCTATATACAAAGGGTGTTTCGTTCAGGGCCACTCCAT
                      ____________________________________________________________
consensus GGGTCACTTTCTATGGCTCTCTGCTATATACAAAGGGTGTTTCGTTCAGGGCCACTCCAT
 
. : . : . : . : . : . :
rJMSF021I24+ CCACAACCGCGGATATTGTGTCTTCACGGATCTCCGGATGGGCCTGGACAATACGTGGCC
rJMSF007M01+ CCACAACCGCGGATATTGTGTCTTCATGGATCTCCGGATGGGCCTGGACAATACGTGGCC
                      ____________________________________________________________
consensus CCACAACCGCGGATATTGTGTCTTCATGGATCTCCGGATGGGCCTGGACAATACGTGGCC
 
. : . : . : . : . : . :
rJMSF021I24+ ATCATGAATTCAATTTTCTCTGCTCAACGTTCAATGGTACCAATAGATTCATGTGCTATA
rJMSF007M01+ ATCATGAATTCAATTTTCTCTGCTCAACGTTCAATGGTACCAATAGATTCATGTGCTATA
                      ____________________________________________________________
consensus ATCATGAATTCAATTTTCTCTGCTCAACGTTCAATGGTACCAATAGATTCATGTGCTATA
 
. : . : . : . : . : . :
rJMSF021I24+ GGAGCCCAGCATTCAGCTTTCTTGCAGCAGGCTTCATACATAACTAATGGTGTATATTTG
rJMSF007M01+ GGAGCCCAGCATTCAGCTTTCTTGCAGCAGGCTTCATACATAACTAATGGTGTATATTTG
                      ____________________________________________________________
consensus GGAGCCCAGCATTCAGCTTTCTTGCAGCAGGCTTCATACATAACTAATGGTGTATATTTG
 
. : . : . : . : . : . :
rJMSF021I24+ AAGCCCCAAATATTAGATGGACTGTTTCAATATCTTTCGACTGTGTTTGCTACTGATTTG
rJMSF007M01+ AAGCCCCAAATATTAGATGGACTGTTTCAATATCTTTCGACTGTGTTTGCTACTGATTTG
                      ____________________________________________________________
consensus AAGCCCCAAATATTAGATGGACTGTTTCAATATCTTTCGACTGTGTTTGCTACTGATTTG
 
. : . : . : . : . : . :
rJMSF021I24+ CATTCTCGTGCCTTTTTACATCTTCCCAGGCCTGTGGGAGTTGACTTCCGTGCTTCGTGC
rJMSF007M01+ CATTCTCGTGCCTTTTTACATCTTCCCAGGCCTGTGGGAGTTGACTTCCGTGCTTCGTGC
                      ____________________________________________________________
consensus CATTCTCGTGCCTTTTTACATCTTCCCAGGCCTGTGGGAGTTGACTTCCGTGCTTCGTGC
 
. : . : . : . : . : . :
rJMSF021I24+ TTTTGCCACAAAAATACAATTGACATGGGCTATATATGCTCTGTTTGTTTATCCATTTTC
rJMSF007M01+ TTTTGCCACAAAAATACAATTGACATGGGCTATATATGCTCTGTTTGTTTATCCATTTTC
                      ____________________________________________________________
consensus TTTTGCCACAAAAATACAATTGACATGGGCTATATATGCTCTGTTTGTTTATCCATTTTC
 
. : . : . : . : . : . :
rJMSF021I24+ TGCAAGCATCAGCCTCAATGCTCGACATGCGGATCGGTTTTTGGTAAGGCTAGAGGACAG
rJMSF007M01+ TGCAAGCATCAGCCTCAATGCTCGACATGCGGATCGGTTTTTGGTAAGGCTAGAGGACAG
                      ____________________________________________________________
consensus TGCAAGCATCAGCCTCAATGCTCGACATGCGGATCGGTTTTTGGTAAGGCTAGAGGACAG
 
. : . : . : . : . : . :
rJMSF021I24+ GAAC---CTGCACCGTAAGATCAGAAGAAAAGACACTGTGGCTAATGGTCATTTTGGGAG
rJMSF007M01+ GAACCTGCTGCGCCGTAAGATCACAAGAAAAGACAC--TGGCTAATGGTCATTTTGGGAG
                      ____________________________________________________________
consensus GAACCTGCTGCGCCGTAAGATCAGAAGAAAAGACACTGTGGCTAATGGTCATTTTGGGAG
 
. : . : . : . : . : . :
rJMSF021I24+ GGTGGCTATTTCCTCTTGTTGCTATGATGCTGTTGGTCCCATCACTCAATTCCATTTGTG
rJMSF007M01+ GGTGACTATTTCCTCTTGTTGCTATGATGCTGTTGGTCACATCACTCAATTCCATTTGTG
                      ____________________________________________________________
consensus GGTGGCTATTTCCTCTTGTTGCTATGATGCTGTTGGTCCCATCACTCAATTCCATTTGTG
 
. : . : . : . : . : . :
rJMSF021I24+ AAGAAGACCTGTTCTGAAGGCTTTTCTTTATGCCCTTTATGGTATGGCTCCATCATTACA
rJMSF007M01+ AAGAAGACCTGTTCTGAAGGCTTTTCTTTATGCCCTTTATGGTATGGCTCCATCATTACA
                      ____________________________________________________________
consensus AAGAAGACCTGTTCTGAAGGCTTTTCTTTATGCCCTTTATGGTATGGCTCCATCATTACA
 
. : . : . : . : . : . :
rJMSF021I24+ GAATAACCGAAACACTGCTGGAATGCATTTTGCAACCAGACATTT
rJMSF007M01+ GAATAACCGAAACACTGCTGGAATGCATTTTGCAACCAGACATTTTGCTAATGTAAACTT
                      ____________________________________________________________
consensus GAATAACCGAAACACTGCTGGAATGCATTTTGCAACCAGACATTTTGCTAATGTAAACTT