Previous Contig 011396:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036B14Sequence528011396 (4)pir|B86213|B862133e-67hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889788 Arabid
JMSF007L24Sequence367011396 (4)gb:AB018560_15139683e-40Citrullus lanatus mRNA for wrp15a, complete cds.607011396 (4)pir|B86213|B862137e-68hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889788 Arabid
JMSF008L24Sequence572011396 (4)pir|B86213|B862137e-67hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889788 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF007L24- AGCTGC
JMFF036B14- ACTCTTCATCAGCTGC
rJMSF007L24+ AGCTGC
                      ____________________________________________________________
consensus ACTCTTCATCAGCTGC
 
. : . : . : . : . : . :
JMSF007L24- GCATCTCATCGTCTCCGGAGCAATCGCGGATCGCCGTCGCCGTCGCAGCAGAGCGTCGTT
JMFF036B14- GCATCTCATCGTCTCCGGAGCAATCGCGGATCGCCGTCGCCGTCGCAGCAGAGCGTCGTT
rJMSF008L24+ CTCCGGAGCAATCGCGGATCGCCGTCGCCGTCGCAGCAGAGCGTCGTT
rJMSF007L24+ GCATCTCATCGTCTCCGGAGCAATCGCGGATCGCCGTCGCCGTCGCAGCAGAGCGTCGTT
                      ____________________________________________________________
consensus GCATCTCATCGTCTCCGGAGCAATCGCGGATCGCCGTCGCCGTCGCAGCAGAGCGTCGTT
 
. : . : . : . : . : . :
JMSF007L24- GCCATCCGTGACTGCCTCCTCCGTCTGTGACTGATTATTGCTAGAAATGGTTAGAGTTAG
JMFF036B14- GCCATCCGTGACTGCCTCCTCCGTCTGTGACTGATTATTGCTAAAAATGGTTAGAGTTAG
rJMSF008L24+ GCCATCCGTGACTGCCTCCTCCGTCTGTGACTGATTATTGCTAGAAATGGTTAGAGTTAG
rJMSF007L24+ GCCATCCGTGACTGCCTCCTCCGTCTGTGACTGATTATTGCTAGAAATGGTTAGAGTTAG
                      ____________________________________________________________
consensus GCCATCCGTGACTGCCTCCTCCGTCTGTGACTGATTATTGCTAGAAATGGTTAGAGTTAG
 
. : . : . : . : . : . :
JMSF007L24- TGTGTTGAATGATGCTCTCAAGAGCATGTACAATGCTGAGAAGAGGGGAAAGCGCCAGGT
JMFF036B14- TGTGTTGAATGATGCTCTCAAGAGCATGTACAATGCTGAGAAGAGGGGAAAGCGCCAGGT
rJMSF008L24+ TGTGTTGAATGATGCTCTCAAGAGCATGTACAATGCTGAGAAGAGGGGAAAGCGCCAGGT
rJMSF007L24+ TGTGTTGAATGATGCTCTCAAGAGCATGTACAATGCTGAGAAGAGGGGAAAGCGCCAGGT
                      ____________________________________________________________
consensus TGTGTTGAATGATGCTCTCAAGAGCATGTACAATGCTGAGAAGAGGGGAAAGCGCCAGGT
 
. : . : . : . : . : . :
JMSF007L24- CATGATTAGGCCTTCTTCAAAAGTGATCATCAAGTTTCTCATTGTGATGCAAAAGCATGG
JMFF036B14- CATGATTAGGCCTTCTTCAAAAGTGATCATCAAGTTTCTCATTGTGATGCAAAAGCATGG
rJMSF008L24+ CATGATTAGGCCTTCTTCAAAAGTGATCATCAAGTTTCTCATTGTGATGCAAAAGCANGG
rJMSF007L24+ CATGATTAGGCCTTCTTCAAAAGTGATCATCAAGTTTCTCATTGTGATGCAAAAGCATGG
                      ____________________________________________________________
consensus CATGATTAGGCCTTCTTCAAAAGTGATCATCAAGTTTCTCATTGTGATGCAAAAGCATGG
 
. : . : . : . : . : . :
JMSF007L24- ATATATTGGGGAATTCGAATTTGTTGATGATCATAGGTCTGGCAAAATCGTAGTTGAGCT
JMFF036B14- ATATATTGGGGAATTCGAATTTGTTGATGATCATAGGTCTGGCAAAATCGTAGTTGAGCT
rJMSF008L24+ ATATATTGGGGAATTCGAATTTGTTGATGATCATAGGTCTGGCAAAATCGTAGTTGAGCT
rJMSF007L24+ ATATATTGGGGAATTCGAATTTGTTGATGATCATAGGTCTGGCAAAATCGTAGTTGAGCT
                      ____________________________________________________________
consensus ATATATTGGGGAATTCGAATTTGTTGATGATCATAGGTCTGGCAAAATCGTAGTTGAGCT
 
. : . : . : . : . : . :
JMSF007L24- CAATGGAAGGCTGAACAAGTGTGGTGTGATTAGTCCTCGGTTTGATATTGGTGTCNAGGA
JMFF036B14- CAATGGAAGGCTGAACAAGTGTGGTGTGATTAGTCCTCGGTTTGATATTGGTGTCAAGGA
rJMSF008L24+ CAATGGAAGGCTGAACAAGTGTGGTGTGATTAGTCCTCGGTTTGATATTGGTGTCAAGGA
rJMSF007L24+ CAATGGAAGGCTGAACAAGTGTGGTGTGATTAGTCCTCGGTTTGATATTGGTGTCAAGGA
                      ____________________________________________________________
consensus CAATGGAAGGCTGAACAAGTGTGGTGTGATTAGTCCTCGGTTTGATATTGGTGTCAAGGA
 
. : . : . : . : . : . :
JMFF036B14- TATCGAAGGATGGACTGCAAGGTTGCTTCCGTCAAGACAGTTCGGCTATATTGTGCTTAC
rJMSF008L24+ TATCGAAGGATGGACTGCAAGGTTGCTTCCGTCAAGACAGTTCGGCTATATTGTGCTTAC
rJMSF007L24+ TATCGAAGGATGGACTGCAAGGTTGCTTCCGTCAAGACAGTTCGGCTATATTGTGCTTAC
                      ____________________________________________________________
consensus TATCGAAGGATGGACTGCAAGGTTGCTTCCGTCAAGACAGTTCGGCTATATTGTGCTTAC
 
. : . : . : . : . : . :
JMFF036B14- TACTTCTGCCGGAATCATGGACCATGAGGAAGCAAGGCGCAAGAATGTTGGANGAAAAGT
rJMSF008L24+ TACTTCTGCCGGAATCATGGACCATGAGGAAGCAAGGCGCAAGAATGTTGGAGGAAAAGT
rJMSF007L24+ TACTTCTGCCGGAATCATGGACCATGAGGAAGCAAGGCGCAAGAATGTTGGAGGAAAAGT
                      ____________________________________________________________
consensus TACTTCTGCCGGAATCATGGACCATGAGGAAGCAAGGCGCAAGAATGTTGGAGGAAAAGT
 
. : . : . : . : . : . :
JMFF036B14- CCTTGGTTTCTTTTATTAAA
rJMSF008L24+ CCTTGGTTTCTTTTATTAGA
rJMSF007L24+ CCTTGGTTTCTTTTATTAGACTTGTTTTGTTGTGTTCGATTTGGATTTTATATTACTCAA
                      ____________________________________________________________
consensus CCTTGGTTTCTTTTATTAGACTTGTTTTGTTGTGTTCGATTTGGATTTTATATTACTCAA
 
. : . : . : . : . : . :
rJMSF007L24+ AAGTGTACCCAGATTTTGTTGCCCTTACTGTTTTTTTGGAAACAATGTTGTTCTTGCTGA
                      ____________________________________________________________
consensus AAGTGTACCCAGATTTTGTTGCCCTTACTGTTTTTTTGGAAACAATGTTGTTCTTGCTGA