Previous Contig 011394:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007L14Sequence405011394 (2)sp|Q43187|IPYR_SOLTU2e-47Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase675011394 (2)gb:AY574053_16158564e-50Populus tomentosa soluble inorganic pyrophosphatase mRNA, complete cds.>gb:AF149

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF007L14- GGCAGTTGCATTTCTACC
                      ____________________________________________________________
consensus GGCAGTTGCATTTCTACC
 
. : . : . : . : . : . :
JMSF007L14- TTGACCTACTTTCACCACCTGTTACGCCATTTTCGTTGAAAACAAGTAATCAGTGAAACA
                      ____________________________________________________________
consensus TTGACCTACTTTCACCACCTGTTACGCCATTTTCGTTGAAAACAAGTAATCAGTGAAACA
 
. : . : . : . : . : . :
JMSF007L14- TGAGCCAATCCAATGAAGTTGCTGCATTTCCACAAAAGCGGACTCCTCGTCTGAATGAGA
                      ____________________________________________________________
consensus TGAGCCAATCCAATGAAGTTGCTGCATTTCCACAAAAGCGGACTCCTCGTCTGAATGAGA
 
. : . : . : . : . : . :
JMSF007L14- GGATCCTCTCTTCTATGTCCAGAAGATCTGTTGCTGCTCATCCTTGGCACGATCTTGAGA
                      ____________________________________________________________
consensus GGATCCTCTCTTCTATGTCCAGAAGATCTGTTGCTGCTCATCCTTGGCACGATCTTGAGA
 
. : . : . : . : . : . :
JMSF007L14- TAGGAGCTGAAGCACCAAAAACTTTCAATGTTGTTATTGAGATTACAAAAGGGAGCAAAG
rJMSF007L14+ CAAAAGGGAGCAAAG
                      ____________________________________________________________
consensus TAGGAGCTGAAGCACCAAAAACTTTCAATGTTGTTATTGAGATTACAAAAGGGAGCAAAG
 
. : . : . : . : . : . :
JMSF007L14- TCAAATATGAACTTGACAAGAAAACTGGTCTGATTAAGGTTGATCGTATCTTGTATTCAT
rJMSF007L14+ TCAAATATGAACTTGACAAGAAAACTGGTCTGATTAAGGTTGATCGTATCTTGTATTCAT
                      ____________________________________________________________
consensus TCAAATATGAACTTGACAAGAAAACTGGTCTGATTAAGGTTGATCGTATCTTGTATTCAT
 
. : . : . : . : . : . :
JMSF007L14- CAGTGGTTTATCCTCACAATTATGGATTCATTCCTAGAACGCTATGTGAAGATAATGATC
rJMSF007L14+ CAGNGGTTTATCCTCNCAATTATGGATTCATTCCTAGAACGCTATGTGAAGATAATGATC
                      ____________________________________________________________
consensus CAGTGGTTTATCCTCACAATTATGGATTCATTCCTAGAACGCTATGTGAAGATAATGATC
 
. : . : . : . : . : . :
JMSF007L14- CAATGGATGTGTTAGTCCTTATGC
rJMSF007L14+ CNAAGGATGNGTTAGTCCTTATGCNGGAGCCTGTTNTTCCNGGNTGTTTTNTCCGAGCTA
                      ____________________________________________________________
consensus CAATGGATGTGTTAGTCCTTATGCNGGAGCCTGTTNTTCCNGGNTGTTTTNTCCGAGCTA
 
. : . : . : . : . : . :
rJMSF007L14+ GGGCCNTAGGGNTAATGCCAATGATTGATCNGGGCGNGAAGGATGATAAAATTATAGCCG
                      ____________________________________________________________
consensus GGGCCNTAGGGNTAATGCCAATGATTGATCNGGGCGNGAAGGATGATAAAATTATAGCCG
 
. : . : . : . : . : . :
rJMSF007L14+ TATGNGCNGATGACCCTGAANATCGCCNTTACNCTGATATCAGCCAGNTACCCCCTCNCC
                      ____________________________________________________________
consensus TATGNGCNGATGACCCTGAANATCGCCNTTACNCTGATATCAGCCAGNTACCCCCTCNCC
 
. : . : . : . : . : . :
rJMSF007L14+ GNTTAGNTGAAATCCGTCGNTTNTTTGAAGNTTACNAGAAGAACGNGAACAAGGNGGTCG
                      ____________________________________________________________
consensus GNTTAGNTGAAATCCGTCGNTTNTTTGAAGNTTACNAGAAGAACGNGAACAAGGNGGTCG
 
. : . : . : . : . : . :
rJMSF007L14+ CNGTTAACGAGTTCCNGCCTTCGGATACTGCTTTTGNGGNTATTAAGTACTCCNTGGACC
                      ____________________________________________________________
consensus CNGTTAACGAGTTCCNGCCTTCGGATACTGCTTTTGNGGNTATTAAGTACTCCNTGGACC
 
. : . : . : . : . : . :
rJMSF007L14+ TNTATGCCGNGTATNTTATGCNGACTTTGNGGAAATAGGTTGATGCCTGAAGGNGGCGCA
                      ____________________________________________________________
consensus TNTATGCCGNGTATNTTATGCNGACTTTGNGGAAATAGGTTGATGCCTGAAGGNGGCGCA
 
. : . : . : . : . : . :
rJMSF007L14+ ACAGAGCTAATTGTTCTGTTTTTGTTTCAACNTNTTACNTTATCAGAGCCCNTCAACNTT
                      ____________________________________________________________
consensus ACAGAGCTAATTGTTCTGTTTTTGTTTCAACNTNTTACNTTATCAGAGCCCNTCAACNTT
 
. : . : . : . : . : . :
rJMSF007L14+ TGTAATCTCGACTGNGGNTTTACCNGNGATAANTTTTTTTTTTTTCGACTGTAATTTACT
                      ____________________________________________________________
consensus TGTAATCTCGACTGNGGNTTTACCNGNGATAANTTTTTTTTTTTTCGACTGTAATTTACT
 
. : . : . : . : . : . :
rJMSF007L14+ TGTGATTTTATTTTGCTTGGATGTTGACCATGCTTTTTAACCATTGCTATGACAATCAAC
                      ____________________________________________________________
consensus TGTGATTTTATTTTGCTTGGATGTTGACCATGCTTTTTAACCATTGCTATGACAATCAAC