Previous Contig 011389:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007K07Sequence337004907 (3)gb:AY563157_16150134e-26Petunia x hybrida benzoyl coenzyme A: benzyl alcohol benzoyl transferase (PhBEBT705011389 (2)gb:AF500202_18061897e-51Nicotiana tabacum benzoyl coenzyme A: benzyl alcohol benzoyl transferase mRNA, c
JMSF019D21Sequence260004907 (3)gb:AY563157_16150137e-15Petunia x hybrida benzoyl coenzyme A: benzyl alcohol benzoyl transferase (PhBEBT680011389 (2)gb:AF500202_18061892e-49Nicotiana tabacum benzoyl coenzyme A: benzyl alcohol benzoyl transferase mRNA, c

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019D21+ CCGCGCTACGTAGTTCTCTCCCTCCCCATTTGCG
rJMSF007K07+ TACAGAGATTTCCGCGCTACGTAGTTCTCTCCCTCCCCATTTGCG
                      ____________________________________________________________
consensus TACAGAGATTTCCGCGCTACGTAGTTCTCTCCCTCCCCATTTGCG
 
. : . : . : . : . : . :
rJMSF019D21+ CAAATGCTCGACAGTTGAGATTCTAACAGCCCTCATGTGGCGGTGCCGCACCATTGCCCT
rJMSF007K07+ CAAATGCTCGACAGTTGAGATTCTAACAGCCCTCATGTGGCGGTGCCGCACCATTGCCCT
                      ____________________________________________________________
consensus CAAATGCTCGACAGTTGAGATTCTAACAGCCCTCATGTGGCGGTGCCGCACCATTGCCCT
 
. : . : . : . : . : . :
rJMSF019D21+ TGGATTCCACCCGGACGAGGAAGTGCGCATGCTTTTACTCATCAATGCACGTTTTAGGTT
rJMSF007K07+ TGGATTCCACCCGGACGAGGAAGTGCGCATGCTTTTACTCATCAATGCACGTTTTAGGTT
                      ____________________________________________________________
consensus TGGATTCCACCCGGACGAGGAAGTGCGCATGCTTTTACTCATCAATGCACGTTTTAGGTT
 
. : . : . : . : . : . :
rJMSF019D21+ CAAAGATTCCCCGGTGCCAAGTGGGTACACCGGCAATGCGTTTGCTTATCCCGGCGCCAA
rJMSF007K07+ CAAAGATTCCCCGGTGCCAAGTGGGTACACCGGCAATGCGTTTGCTTATCCCGGCGCCAA
                      ____________________________________________________________
consensus CAAAGATTCCCCGGTGCCAAGTGGGTACACCGGCAATGCGTTTGCTTATCCCGGCGCCAA
 
. : . : . : . : . : . :
rJMSF019D21+ AACGACAGCCGGAAAATTGAGGAAAAACCCATTGGGTTACGCGGTTGAGTTGGTCACAAG
rJMSF007K07+ AACGACAGCCGGAAAATTGAGGAAAAACCCATTGGGTTACGCGGTTGAGTTGGTCACAAG
                      ____________________________________________________________
consensus AACGACAGCCGGAAAATTGAGGAAAAACCCATTGGGTTACGCGGTTGAGTTGGTCACAAG
 
. : . : . : . : . : . :
rJMSF019D21+ CATCAAACGTTGCTTTAGCGAAGAGTACATGCAATCCGTGATGGACTTGATGGTTCTTAA
rJMSF007K07+ CATCAAACGTTGCTTTAGCGAAGAGTACATGCAATCCGTGATGGACTTGATGGTTCTTAA
                      ____________________________________________________________
consensus CATCAAACGTTGCTTTAGCGAAGAGTACATGCAATCCGTGATGGACTTGATGGTTCTTAA
 
. : . : . : . : . : . :
rJMSF019D21+ GGGCCGACCGCCCTTCCATGTTGCCGGAAGTTTTATTATGTCGGATCTCACGTACCCGTT
rJMSF007K07+ GGGCCGACCGCCCTTCCATGTTGCCGGAAGTTTTATTATGTCGGATCTCACGTACCCGTT
                      ____________________________________________________________
consensus GGGCCGACCGCCCTTCCATGTTGCCGGAAGTTTTATTATGTCGGATCTCACGTACCCGTT
 
. : . : . : . : . : . :
rJMSF019D21+ CTAAAATACCTGATGTGGATTACGGTTGGGGCAAAGCAGTTTTTGGCGGGGTGGCTCATG
rJMSF007K07+ CTAAAATACCTGATGTGGATTACGGTTGGGGCAAAGCAGTTTTTGGCGGGGTGGCTCATG
                      ____________________________________________________________
consensus CTAAAATACCTGATGTGGATTACGGTTGGGGCAAAGCAGTTTTTGGCGGGGTGGCTCATG
 
. : . : . : . : . : . :
rJMSF019D21+ GAGGTGCCGGTGATGTTCCAGGTGTGATTACCTTTCACGTGCCATATGAAAATAAGAAAG
rJMSF007K07+ GAGGTGCCGGTGATGTTCCAGGTGTGATTACCTTTCACGTGCCATATGAAAATAAGAAAG
                      ____________________________________________________________
consensus GAGGTGCCGGTGATGTTCCAGGTGTGATTACCTTTCACGTGCCATATGAAAATAAGAAAG
 
. : . : . : . : . : . :
rJMSF019D21+ GCGAAAATGGCACTTTGATTCCTATTTGCTTGCCGGCCGTCGCAATGGACAAATTTGTGA
rJMSF007K07+ GCGAAAATGGCACTTTGATTCCTATTTGCTTGCCGGCCGTCGCAATGGACAAATTTGTGA
                      ____________________________________________________________
consensus GCGAAAATGGCACTTTGATTCCTATTTGCTTGCCGGCCGTCGCAATGGACAAATTTGTGA
 
. : . : . : . : . : . :
rJMSF019D21+ ATGAGCTAGCAAATACTTTCATCAGGGCTGCTTTATGAATGAGTCTGCATGAATAGCTCG
rJMSF007K07+ ATGAGCTAGCAAATACTTTCATCAGGGCTGCTTTATGAATGAGTCTGCATGAATAGCTCG
                      ____________________________________________________________
consensus ATGAGCTAGCAAATACTTTCATCAGGGCTGCTTTATGAATGAGTCTGCATGAATAGCTCG
 
. : . : . : . : . : . :
rJMSF019D21+ GTTGGTTACTGAGTGACAAATTATTAGCAGATCAAGTGTTAAGAAC
rJMSF007K07+ GTTGGTTACTGAGTGACAAATTATTAGCAGATCAAGTGTTAAGAACTTAAGATTCAGTAA
                      ____________________________________________________________
consensus GTTGGTTACTGAGTGACAAATTATTAGCAGATCAAGTGTTAAGAACTTAAGATTCAGTAA