Previous Contig 011383:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007J09Sequence461007556 (2)gb:AB012246_15117923e-21Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRG7.>gb:AY093186_15751774011383 (2)gb:AB012246_15117922e-45Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRG7.>gb:AY093186_15751
JMSF043H07Sequence793007556 (2)gb:AB012246_15117923e-12Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRG7.>gb:AY093186_15751776011383 (2)gb:AB012246_15117922e-50Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRG7.>gb:AY093186_15751

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043H07+ AATTGCGTGATCTTTGCTAGGTATTGTCAGATGAATCAACCAGAAC
                      ____________________________________________________________
consensus AATTGCGTGATCTTTGCTAGGTATTGTCAGATGAATCAACCAGAAC
 
. : . : . : . : . : . :
rJMSF043H07+ CCAATATGATAGGGCTCTCCAATATCAAGAAGACACGGGCAGGACAGTGGTGGGCAATTG
rJMSF007J09+ TGATAGGGCTCTCCAATATCAAGAAGACACGGNCAGGACAGTGGTGGGCAATTG
                      ____________________________________________________________
consensus CCAATATGATAGGGCTCTCCAATATCAAGAAGACACGGGCAGGACAGTGGTGGGCAATTG
 
. : . : . : . : . : . :
rJMSF043H07+ GGATCACAACTTTGGATATGAAGATGAGTCAAGGACCTATAGGTGGGCTGAAGTCAGACG
rJMSF007J09+ GGATCACAACTTNGGATATGAAGATGAGTCAAGGACCTATAGGTGGGCTGAAGTCAGACG
                      ____________________________________________________________
consensus GGATCACAACTTTGGATATGAAGATGAGTCAAGGACCTATAGGTGGGCTGAAGTCAGACG
 
. : . : . : . : . : . :
rJMSF043H07+ AAAAATGCAACAGGAGACATATTGGGAACAGTATCACAAGAAAGAAAATTTTTCTTTTTA
rJMSF007J09+ AAAAATGCAACAGGAGACATATTGGGAACAGTATCACAAGAAAGAAAATTTTTCTTTTTA
                      ____________________________________________________________
consensus AAAAATGCAACAGGAGACATATTGGGAACAGTATCACAAGAAAGAAAATTTTTCTTTTTA
 
. : . : . : . : . : . :
rJMSF043H07+ TTATGAAACAGAGGATGGGTCAGATGAAGAAAGTCTTGATGAAGAAAGAGGTCCCTTTCT
rJMSF007J09+ TTATGAAACAGAGGATGGGTCAGATGAAGAAAGTCTTGATGAAGAAAGAGGTCCCTTTCT
                      ____________________________________________________________
consensus TTATGAAACAGAGGATGGGTCAGATGAAGAAAGTCTTGATGAAGAAAGAGGTCCCTTTCT
 
. : . : . : . : . : . :
rJMSF043H07+ TGAAGTGCTTAGATCTGCCTTTCTCTCTCTGTTCCTAATGTACACAGTAGGCATTCGGCT
rJMSF007J09+ TGAAGTGCTTAGATCTGCCTTTCTCTCTCTGTTCCTAATGTACACAGTAGGCATTCGGCT
                      ____________________________________________________________
consensus TGAAGTGCTTAGATCTGCCTTTCTCTCTCTGTTCCTAATGTACACAGTAGGCATTCGGCT
 
. : . : . : . : . : . :
rJMSF043H07+ ATCTTTGACGTTTAGTAGCCTTATGGCCTTGCTTGACCGGAAGTTGGATGCTGGATACAA
rJMSF007J09+ ATCTTTGACGTTTAGTAGCCTTATGGCCTTGCTTGACCGGAAGTTGGATGCTGGATACAA
                      ____________________________________________________________
consensus ATCTTTGACGTTTAGTAGCCTTATGGCCTTGCTTGACCGGAAGTTGGATGCTGGATACAA
 
. : . : . : . : . : . :
rJMSF043H07+ AATAGGTTATGTGCTTGCTTGGGTACTGGGAGGCCGAGGTGGCATTTTACTTACATTATG
rJMSF007J09+ AATAGGTTATGTGCTTGCTTGGGTACTGGGAGGCCGAGGTGGCATTTTACTTACATTATG
                      ____________________________________________________________
consensus AATAGGTTATGTGCTTGCTTGGGTACTGGGAGGCCGAGGTGGCATTTTACTTACATTATG
 
. : . : . : . : . : . :
rJMSF043H07+ CCTTTTGTTTGCAAGTTGGCTGTGCGGAAAAACCAGCAGCAGCGTAGTCGTTCTGGTGGT
rJMSF007J09+ CCTTTTGTTTGCAAGTTGGCTGTGCGGAAAAACCAGCAGCAGCGTAGTCGTTCTGGTGGT
                      ____________________________________________________________
consensus CCTTTTGTTTGCAAGTTGGCTGTGCGGAAAAACCAGCAGCAGCGTAGTCGTTCTGGTGGT
 
. : . : . : . : . : . :
rJMSF043H07+ CGTAGCCATGTGGATTGGTTCAAATCTTGCAAGGTTTGCTCCGCTTCCGCAAGGTGCTAT
rJMSF007J09+ CGTAGCCATGTGGATTGGTTCAAATCTTGCAAGGTTTGCTCCGCTTCCGCAAGGTGCTAT
                      ____________________________________________________________
consensus CGTAGCCATGTGGATTGGTTCAAATCTTGCAAGGTTTGCTCCGCTTCCGCAAGGTGCTAT
 
. : . : . : . : . : . :
rJMSF043H07+ TCTTACCCTCTTGTACATGTCAATCAAGTTACAAGTTGATCTGAACTAAATCCACACTGA
rJMSF007J09+ TCTTACCCTCTTGTACATGTCAATCAAGTTACAAGTTGATCTGAACTAAATCCACACTGA
                      ____________________________________________________________
consensus TCTTACCCTCTTGTACATGTCAATCAAGTTACAAGTTGATCTGAACTAAATCCACACTGA
 
. : . : . : . : . : . :
rJMSF043H07+ CACTGCTGTCTGAGTTTATGTCTGTAAATATGTTGATGTCTTGCCTTGTATTGTATAAGA
rJMSF007J09+ CACTGCTGTCTGAGTTTATGTCTGTAAATATGTTGATGTCTTGCCTTGTATTGTATAAGA
                      ____________________________________________________________
consensus CACTGCTGTCTGAGTTTATGTCTGTAAATATGTTGATGTCTTGCCTTGTATTGTATAAGA
 
. : . : . : . : . : . :
rJMSF043H07+ AGGAAATAAGATAATTGTCTAGTGTAAATTCATGTCTTGGGTGTAGTCTCCACTCTCCAT
rJMSF007J09+ AGGAAATAAGATAATTGTCTAGTGTAAATTCATGTCTTGGGTGTAGTCTCCACTCTCCAT
                      ____________________________________________________________
consensus AGGAAATAAGATAATTGTCTAGTGTAAATTCATGTCTTGGGTGTAGTCTCCACTCTCCAT
 
. : . : . : . : . : . :
rJMSF043H07+ TTCCTTCTGT
rJMSF007J09+ TTCCTTCTGTTCACCTCTTTGAATAAATTGGAAAATTTATTCTTATTCTCAAACATTTTG
                      ____________________________________________________________
consensus TTCCTTCTGTTCACCTCTTTGAATAAATTGGAAAATTTATTCTTATTCTCAAACATTTTG