Previous Contig 011380:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005A10Sequence257006145 (8)278011380 (6)
JMSF005C12Sequence279004682 (10)391011380 (6)
JMSF007H14Sequence279004889 (5)750011380 (6)
JMSF030M22Sequence618004682 (10)sp|Q9SX38|DRL4_ARATH5e-07Putative disease resistance protein At1g50180.>pir|B96538|B96538 hypothetical pr607011380 (6)
JMSF038C24Sequence673004682 (10)sp|Q9SX38|DRL4_ARATH3e-08Putative disease resistance protein At1g50180.>pir|B96538|B96538 hypothetical pr843011380 (6)gb:AC145120_17442731e-14Solanum demissum chromosome 5 BAC PGEC446O19 genomic sequence, complete sequence
JMSF045O09Sequence712004682 (10)gb:AY062798_15654541e-19Arabidopsis thaliana disease resistance protein, putative (At1g58390; F9K23.8) m594011380 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038C24+ TCGAGTGGAA
                      ____________________________________________________________
consensus TCGAGTGGAA
 
. : . : . : . : . : . :
rJMSF038C24+ GGAACTTGAGTGCTTTGGGGGTCGTTGGATGAGCTCGAGGTGTTAAAGCTGGAGGACAAT
                      ____________________________________________________________
consensus GGAACTTGAGTGCTTTGGGGGTCGTTGGATGAGCTCGAGGTGTTAAAGCTGGAGGACAAT
 
. : . : . : . : . : . :
rJMSF038C24+ GCGTTTAGAGGAGAGTTCTGTGATGTAAGGAGCGTTGTGTTCAAACAACTGCAGTATTTT
                      ____________________________________________________________
consensus GCGTTTAGAGGAGAGTTCTGTGATGTAAGGAGCGTTGTGTTCAAACAACTGCAGTATTTT
 
. : . : . : . : . : . :
rJMSF038C24+ CGCATCGAAAGGACTGATTTAGTATCATGGACAGCTTCGAAAGATAGTTTTCCAGTACTA
                      ____________________________________________________________
consensus CGCATCGAAAGGACTGATTTAGTATCATGGACAGCTTCGAAAGATAGTTTTCCAGTACTA
 
. : . : . : . : . : . :
rJMSF030M22+ GTTGAGTTTGGTGAA
rJMSF045O09+ CCGGTTGAGTTTGGTGAA
rJMSF038C24+ AAATGTCTGTTGCTCAGAAACTGCACTAAGCTTGATTCTGTTCCGGTTGAGTTTGGTGAA
                      ____________________________________________________________
consensus AAATGTCTGTTGCTCAGAAACTGCACTAAGCTTGATTCTGTTCCGGTTGAGTTTGGTGAA
 
. : . : . : . : . : . :
rJMSF030M22+ ATAGAGAGCCTTAAGTTGTTGGAATTGTATTGCACCAACAAGGGGGCAGTGAATTCTGCT
rJMSF045O09+ ATAGAGAGCCTTAAGTTGTTGGAATTGTATTGCACCAACAAGGGGGCAGTGAATTCTGCT
rJMSF038C24+ ATAGAGAGCCTTAAGTTGTTGGAATTGTATTGCACCAACAAGGGGGCAGTGAATTCTGCT
                      ____________________________________________________________
consensus ATAGAGAGCCTTAAGTTGTTGGAATTGTATTGCACCAACAAGGGGGCAGTGAATTCTGCT
 
. : . : . : . : . : . :
rJMSF030M22+ AAAAAAATACAGGAGCTGAAAAGAGGTGTAAATGGAGATACAAAAAAGGGTGGATTTCAG
rJMSF045O09+ AAAAAAATACAGGAGCTGAAAAGAGGTGTAAATGGAGATACAAAAAAGGGTGGATTTCAG
rJMSF038C24+ AAAAAAATACAGGAGCTGAAAAGAGGTGTAAATGGAGATACAAAAAAGGGTGGATTTCAG
                      ____________________________________________________________
consensus AAAAAAATACAGGAGCTGAAAAGAGGTGTAAATGGAGATACAAAAAAGGGTGGATTTCAG
 
. : . : . : . : . : . :
rJMSF005C12+ GGAGGTAATGCCAAGTTGTCC
rJMSF005A10+ GGAGGTAATGCCAAGTTGTCC
rJMSF030M22+ CTCTCTGTCTATCCTCCTGAGCAGTGAGGTTTCCGTGGAGGAGGTAATGGCAAGTTGTCC
rJMSF045O09+ CTCTCTGTCTATCCTCCTGAGCAGTGAGGTTTCCGTGGAGGAGGTAATGGCAAGTTGTCC
rJMSF038C24+ CTCTCTGTCTATCCTCCTGAGCAGTGAGGTTTCCGTGGAGGAGGTAATGGCAAGTTGTCC
                      ____________________________________________________________
consensus CTCTCTGTCTATCCTCCTGAGCAGTGAGGTTTCCGTGGAGGAGGTAATGGCAAGTTGTCC
 
. : . : . : . : . : . :
rJMSF005C12+ CATCAGTCCTTATTGTAAAAAGGGTTTCATCGCATCTGATCAGTCAAGGTCTCTTGTTAC
rJMSF005A10+ CATCAGTCCTTATTGTAAAAAGGGTTTCATCGCATCTGATCAGTCAAGGTCTCTTGNTAC
rJMSF030M22+ CATCAGTCCTTATTGTAAAAAGGGTTTCATCGCATCTGATCAGTCAAGGTCTCTTGTTAC
rJMSF045O09+ CATCAGTCCTTATTGTAAAAAGGGTTTCATCGCATC--ATCAGTCAAGGTCTCTTGTTAC
rJMSF038C24+ CATCAGTCCTTATTGTAAAAAGGGTTTCATCGCATCTGATCAGTCAAGGTCTCTTGTTAC
                      ____________________________________________________________
consensus CATCAGTCCTTATTGTAAAAAGGGTTTCATCGCATCTGATCAGTCAAGGTCTCTTGTTAC
 
. : . : . : . : . : . :
rJMSF005C12+ AGTTCGAGCAAAGTTGTAAGGTGATCAGTNGAATCAATTGAGCTAGCTAGCAAGGCTTGA
rJMSF005A10+ AGTNCGAGCAAAGTTTTAAGGTGATCAGTTGAATCAATTGAGCTAGCTAGCAAGGCTTGA
rJMSF030M22+ AGTTCGAGCAAAGTTTTAAGGTGATCAGTTGAATCAATTGAGCTAGCTAGCAAGGCTTGA
rJMSF045O09+ AGTTCGAGCAAAGTTTTAAGGTGATCAGTTGAATCAATTGAGCTAGCTAGCAAGGCTTGA
rJMSF038C24+ AGTTCGAGCAAAGTTTTAAGGTGATCAGTTGAATCAATTGAGCTAGCTAGCAAGGCTTGA
                      ____________________________________________________________
consensus AGTTCGAGCAAAGTTTTAAGGTGATCAGTTGAATCAATTGAGCTAGCTAGCAAGGCTTGA
 
. : . : . : . : . : . :
rJMSF005C12+ TTGGTCAATTTATGGATGGCNTTNTGATTGTGATTTCTACCAAATGGTGAAATAAGTGGG
rJMSF005A10+ TTGGTCAATTTATGGATGGCTTTCTGATTGTGATTTCTACCAAATGGTGAAATAAGTGGG
rJMSF030M22+ TTGGTCAATTTATGGATGGCTTTCTGATTGTGATTTCTACCAAATGGTGAAATAAGTGGG
rJMSF045O09+ TTGGTCAATTTATGGATGGCTTTCTGATTGTGATTTCTACCAAATGGTGAAATAAGTGGG
rJMSF038C24+ TTGGTCAATTTATGGATGGCTTTCTGATTGTGATTTCTACCAAATGGTGAAATAAGTGGG
rJMSF007H14+ CAATTTATGGATGACTTTCTGATTGTGATTTCTACAAAATGCTGAAATAAGTGGG
                      ____________________________________________________________
consensus TTGGTCAATTTATGGATGGCTTTCTGATTGTGATTTCTACCAAATGGTGAAATAAGTGGG
 
. : . : . : . : . : . :
rJMSF005C12+ CAACGCGAATTTGTTCCGACCATTCCATTCACTGTACCTGCTTGCCAATTTGTGTGCAGA
rJMSF005A10+ CAACGCGAATTNGTTCCGACCATTCCATTCACNGTACCTGCTTGCCAATTTGTGTGCANA
rJMSF030M22+ CAACGCGAATTTGTTCCGACCATTCCATTCACTGTACCTGCTTGCCAATTTGTGTGCAGA
rJMSF045O09+ CAACGCGAATTTGTTCCGACCATTCCATTCACTGTACCTGCTTGCCAATTTGTGTGCAGA
rJMSF038C24+ CAACGCGAATTTGTTCCGACCATTCCATTCACTGTACCTGCTTGCCAATTTGTGTGCAGA
rJMSF007H14+ CAACACAAATTTGTTCCGACCATTCCATTCAACGTACCTGCTTTCCAATTTGTGTGCAGA
                      ____________________________________________________________
consensus CAACGCGAATTTGTTCCGACCATTCCATTCACTGTACCTGCTTGCCAATTTGTGTGCAGA
 
. : . : . : . : . : . :
rJMSF005C12+ CTGCATATTCTTGTTACTGTCTTGCGATTTGAGTTGGAGTNTGATTCGTTTGGTTNGTTT
rJMSF005A10+ CTGCATATTCTTGT
rJMSF030M22+ CTGCATATTCTTGTTACTGTCTTGCGATTTGAGTTGGAGTTTGATTTGTTTGGTTTGTTT
rJMSF045O09+ CTGCATATTCTTGTTACTGTCTTGCGATTTGAGTTGGAGTTTGATTTGTTTGGTTTGTTT
rJMSF038C24+ CTGCATATTCTTGTTACTGTCTTGCGATTTGAGTTGGAGTTTGATTTGTTTGGTTTGTTT
rJMSF007H14+ TNGCATAT-----TTACNGTCTTGCTATTTGAGTTGGATTTTGATTTGGTTTGTTTGTTT
                      ____________________________________________________________
consensus CTGCATATTCTTGTTACTGTCTTGCGATTTGAGTTGGAGTTTGATTTGTTTGGTTTGTTT
 
. : . : . : . : . : . :
rJMSF005C12+ TATCATGGTTGGNTGTTGTTCTTGGTNGTCNTGGCTTCTCATTGAATATTACTCTGNAAA
rJMSF030M22+ TATCATGGTTGGTTGTTGTT-TTGGTTGTCTTGGCTTCTCATTGAATATTACTCTGTAAA
rJMSF045O09+ TATCATGGTTGGTTGTTGTT-TTGGTTGTCTTGGCTTCTCATTGAATATTACTCTGTAAA
rJMSF038C24+ TATCATGGTTGGTTGTTGTT-TTGGTTGTCTTGGCTTCTCATTGAATATTACTCTGTAAA
rJMSF007H14+ TATCATGGCTGGTTGTTGTT-TTGGTTGTCTTGGCTTCTCATTGAATATTACTCTGTAAA
                      ____________________________________________________________
consensus TATCATGGTTGGTTGTTGTT-TTGGTTGTCTTGGCTTCTCATTGAATATTACTCTGTAAA
 
. : . : . : . : . : . :
rJMSF005C12+ CA-CTCATT
rJMSF030M22+ CA-CTCATTTNGGTGCTTTAAAATAAAATA-CGGAGTAAATAAATGT
rJMSF045O09+ CA-CTCATTTTGGTGCTTTAAAATAAAATAC
rJMSF038C24+ CACCTCATTTTGGTGCTTTAAAATAAAATACCGGAGTAAATAAATGT
rJMSF007H14+ CA-CTCATTTTGGTGCTTTAAAATAAAATA-CGGAGTAAATAAATGTTATTTAGTTATTT
                      ____________________________________________________________
consensus CA-CTCATTTTGGTGCTTTAAAATAAAATACCGGAGTAAATAAATGTTATTTAGTTATTT
 
. : . : . : . : . : . :
rJMSF007H14+ CCAAAAATAAATGTTATTTAGTTTCTTATTTTAAATTTTTTTTAAAGGAATTTTTAAATT
                      ____________________________________________________________
consensus CCAAAAATAAATGTTATTTAGTTTCTTATTTTAAATTTTTTTTAAAGGAATTTTTAAATT
 
. : . : . : . : . : . :
rJMSF007H14+ TTTTATTCATCTCTAAATTTATAGTCAAACTTGTATAAGATCATATCGGTTAGACAGAAT
                      ____________________________________________________________
consensus TTTTATTCATCTCTAAATTTATAGTCAAACTTGTATAAGATCATATCGGTTAGACAGAAT
 
. : . : . : . : . : . :
rJMSF007H14+ TTAGAATAGTTGTTTGGTACTTTGGATAGAAGTCATAGTACTTAATACAGAAAATNTAAT
                      ____________________________________________________________
consensus TTAGAATAGTTGTTTGGTACTTTGGATAGAAGTCATAGTACTTAATACAGAAAATNTAAT
 
. : . : . : . : . : . :
rJMSF007H14+ ACTAATTTGAATTAAACAAATTGTTACCTTATAATAGATATTGTAATATTTATATGCTAG
                      ____________________________________________________________
consensus ACTAATTTGAATTAAACAAATTGTTACCTTATAATAGATATTGTAATATTTATATGCTAG