Previous Contig 011378:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS035H02Sequence598011378 (2)gb:OSJN00112_16951241e-49Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0103I08, complete seque
JMSF007H06Sequence405018523gb:AB015476_15126028e-25Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.746011378 (2)gb:AB015476_15126024e-76Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS035H02+ TAAGCATATTACAACCATTACTCTTTGG
rJMSF007H06- AGCATATTACAACCATTACTCTTTGG
                      ____________________________________________________________
consensus TAAGCATATTACAACCATTACTCTTTGG
 
. : . : . : . : . : . :
JMFS035H02+ CCACTTTATTATGCACTAAAAGTTGACCAATTGCACATTATAAATGATCTTCAATAGCTG
rJMSF007H06- CCACTTTATTATGCACTAAAAGTTGACCAATTGCACATTATAAATGATCTTCAATAGCTG
                      ____________________________________________________________
consensus CCACTTTATTATGCACTAAAAGTTGACCAATTGCACATTATAAATGATCTTCAATAGCTG
 
. : . : . : . : . : . :
JMFS035H02+ CTTTTGTAAACTTTTTATCATTATTGCATTCTGTCTACATCTCTAATTAGGCTCACCTCT
rJMSF007H06- CTTTTGTAAACTTTTTATCATTATTGCATTCTGTCTACATCTCTAATTAGGCTCACCTCT
                      ____________________________________________________________
consensus CTTTTGTAAACTTTTTATCATTATTGCATTCTGTCTACATCTCTAATTAGGCTCACCTCT
 
. : . : . : . : . : . :
JMFS035H02+ ATCTTTTCTAACTAGACATTCTTCCAAAAGCCTAATTGTAGTGTCTGGCAATGCCAACCT
rJMSF007H06- ATCTTTTCTAACTAGACATTCTTCCAAAAGCCTAATTGTAGTGTCTGGCAATGCCAACCT
                      ____________________________________________________________
consensus ATCTTTTCTAACTAGACATTCTTCCAAAAGCCTAATTGTAGTGTCTGGCAATGCCAACCT
 
. : . : . : . : . : . :
JMFS035H02+ TTTAAACTTTTAGGATGCCTTTGCAGGCAAAAAGGTCATGCAGATTGGAGCTTTGACTTT
rJMSF007H06- TTTAAACTTTTAGGATGCCTTTGCAGGCAAAAAGGTCATGCAGATTGGAGCTTTGACTTT
                      ____________________________________________________________
consensus TTTAAACTTTTAGGATGCCTTTGCAGGCAAAAAGGTCATGCAGATTGGAGCTTTGACTTT
 
. : . : . : . : . : . :
JMFS035H02+ GGCCAATGCGAGTATCGACTGTGGGAGGATCCACAATCCATCGCCACAGATCAGACCCGA
rJMSF007H06- GGCCAATGCGAGTATCGACTGTGGGAGGATCCACAATCCATCGCCACAGATCAGACCCGA
                      ____________________________________________________________
consensus GGCCAATGCGAGTATCGACTGTGGGAGGATCCACAATCCATCGCCACAGATCAGACCCGA
 
. : . : . : . : . : . :
JMFS035H02+ TGCAACTGCAGGGACCATCAGAGTCGCCTTCTTGCGGTTGAGCCTGTGCCATGTGTACAC
rJMSF007H06- TGCAACTGCAGGGACCATCAGAGTCGCCTTCTTGCGGTTGAGCCTGTGCCATGTGTACAC
                      ____________________________________________________________
consensus TGCAACTGCAGGGACCATCAGAGTCGCCTTCTTGCGGTTGAGCCTGTGCCATGTGTACAC
 
. : . : . : . : . : . :
JMFS035H02+ AACGAGACTACCCATACACATATCAATTGCGAAAGAAGCCCCAACGAGAAAAGGAACAGC
rJMSF007H06- AACGAGACTACCCATACACATATCAATTGCGAAAGAAGCCCCAACGAGAAAAGGAACAGC
                      ____________________________________________________________
consensus AACGAGACTACCCATACACATATCAATTGCGAAAGAAGCCCCAACGAGAAAAGGAACAGC
 
. : . : . : . : . : . :
JMFS035H02+ CATAGCCATCGGGAGGGGGATCCATTTCCCGACGTTCTTTGGGGATAAGTCTTTCAGCAG
rJMSF007H06- CATAGCCATCGGGAGGGGGATCCATTTCCCGACGTTCTTTGGGGATAAGTCTTTCAGCAG
                      ____________________________________________________________
consensus CATAGCCATCGGGAGGGGGATCCATTTCCCGACGTTCTTTGGGGATAAGTCTTTCAGCAG
 
. : . : . : . : . : . :
JMFS035H02+ GTTGGCAACCATGGCAAAGACGAAGAACCCATAACAGAGCTGCAAGCAATGCTGGGGAAG
rJMSF007H06- GTTGGCAACCATGGCAAAGACGAAGAACCCATAACAGAGCTGCAAGCAATGCTGGGGAAG
                      ____________________________________________________________
consensus GTTGGCAACCATGGCAAAGACGAAGAACCCATAACAGAGCTGCAAGCAATGCTGGGGAAG
 
. : . : . : . : . : . :
JMFS035H02+ CGTAGAGAAGCCTTCAACGGCTAGGATGGC
rJMSF007H06- CGTAGAGAAGCCTTCAACGGCTAGGATGGCCATGTTTCTATATATAATAGCGTAAGGAGC
                      ____________________________________________________________
consensus CGTAGAGAAGCCTTCAACGGCTAGGATGGCCATGTTTCTATATATAATAGCGTAAGGAGC
 
. : . : . : . : . : . :
rJMSF007H06- TTTGTACTCCCCATCCGGGTTCCCCACGTCAAATGTCTTGTAGAAGAGGAAGAACGAGAG
                      ____________________________________________________________
consensus TTTGTACTCCCCATCCGGGTTCCCCACGTCAAATGTCTTGTAGAAGAGGAAGAACGAGAG
 
. : . : . : . : . : . :
rJMSF007H06- AGGAGCCACTATACAACCCATGGCAGTTCCNACCGCTTGGCTAAGGAGCATCGATCGAGG
                      ____________________________________________________________
consensus AGGAGCCACTATACAACCCATGGCAGTTCCNACCGCTTGGCTAAGGAGCATCGATCGAGG