Previous Contig 011364:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001N17Sequence543001259 (9)gb:AY058177_15643132e-32Arabidopsis thaliana At2g24280/F27D4.19 mRNA, complete cds.>gb:AY142011_1582848 788011364 (6)gb:AP003371_18286293e-67Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMSF003A07Sequence229004467 (2)747011364 (6)gb:AP003371_18286291e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMSF007C19Sequence366004862 (6)764011364 (6)
JMSF010P14Sequence701011364 (6)gb:AP003371_18286292e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMSF032P18Sequence682001259 (9)gb:AY058177_15643139e-55Arabidopsis thaliana At2g24280/F27D4.19 mRNA, complete cds.>gb:AY142011_1582848 768011364 (6)gb:AP003371_18286297e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B114
JMSF041K06Sequence675004862 (6)gb:BT014908_16418982e-07Arabidopsis thaliana At5g54075 gene, complete cds.>gb:BT015029_1641999 Arabidops666011364 (6)gb:AY058177_15643139e-04Arabidopsis thaliana At2g24280/F27D4.19 mRNA, complete cds.>gb:AY142011_1582848

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032P18+ TAGAGAGACTCAGAAAATCNTTCCN
rJMFF001N17+ GTGGATTAGAGAGACTCAGAAAATCATT-CA
                      ____________________________________________________________
consensus GTGGATTAGAGAGACTCAGAAAATCATTCCA
 
. : . : . : . : . : . :
rJMSF032P18+ GGATATGCAGCAAGACAAATTTTAGTATAGGCAGCCTTGTAGATTGGCTTGGTTCAGCAT
rJMSF003A07+ GGATATGCAGCNAGACAAATTTTAGTATAGGCAGCCTTGTAGATTGGCTTGGTTCAGCAT
rJMFF001N17+ GGATATGCAGCAAGACAAATTTTAGTATAGGCAGCCTTGTAGATTGGCTTGGTTCAGCAT
                      ____________________________________________________________
consensus GGATATGCAGCAAGACAAATTTTAGTATAGGCAGCCTTGTAGATTGGCTTGGTTCAGCAT
 
. : . : . : . : . : . :
rJMSF010P14+ AACTCCTGGAAACCTCTTCAATCCGTTGCCAC
rJMSF032P18+ ACATTTCCACAGCCATGGCTGATTATCCAACTCCTGGAAACCTCTTCAATCCGTTGCCAC
rJMSF003A07+ ACATTTCCACAGCCATGGCTGATTATCCAACTCCTGGAAACCTCTTCAATCCGTTGCCAC
rJMFF001N17+ ACATTTCCACAGCCATGGCTGATTATCCAACTCCTGGAAACCTCTTCAATCCGTTGCCAC
                      ____________________________________________________________
consensus ACATTTCCACAGCCATGGCTGATTATCCAACTCCTGGAAACCTCTTCAATCCGTTGCCAC
 
. : . : . : . : . : . :
rJMSF010P14+ CTTATCCTATCAAACAAATGTGTAAAGCAATTGATGATCCAAGGCATGGGAGTGACCCAG
rJMSF032P18+ CTTATCCTATCAAACAAATGTGTAAAGCAATTGATGATCCAAGGCATGGGAGTGACCCAT
rJMSF003A07+ CTTATCCTATCAAACAAATGTGTAAAGCAATTGATGATCCAAGGCATGGGAGTGACCCAG
rJMFF001N17+ CTTATCCTATCAAACAAATGTGTAAAGCAATTGATGATCCAAGGCATGGGAGTGACCCAG
                      ____________________________________________________________
consensus CTTATCCTATCAAACAAATGTGTAAAGCAATTGATGATCCAAGGCATGGGAGTGACCCAG
 
. : . : . : . : . : . :
rJMSF010P14+ TGAAGAAGCTGTATGCAGCAGTGAACATATGCTATAACTACAGCAGGGAAGTCAATTGTT
rJMSF032P18+ TGAAGAAGCTGTATGCAGCAGTGAACATATGCTATAACTACAGCAGGGAAGTCAATTGTT
rJMSF003A07+ TGAAGAAGCTGTATGCAGCAGTGAACATATGCTATAACTACAGCAGGGAAGTCAATTGTT
rJMFF001N17+ TGAAGAAGCTGTATGCAGCAGTGAACATATGCTATAACTACAGCAGGGAAGTCAATTGTT
                      ____________________________________________________________
consensus TGAAGAAGCTGTATGCAGCAGTGAACATATGCTATAACTACAGCAGGGAAGTCAATTGTT
 
. : . : . : . : . : . :
rJMSF010P14+ TTGATCCCGGAAATCCTTTAGATTTTGAACAAAGTGCTGCACAGTGGAACTGGCAGATTT
rJMSF032P18+ TTGATCCCGGAAATCCTTTAGATTTTGAACAAAGTGCTGCACAGTGGAACTGGCAGATTT
rJMSF003A07+ TTGATCCCGGAAATCCTTTAGATTTTGAACAAAGTGCTGCACAGTGGAACTGGCAGATTT
rJMFF001N17+ TTGATCCCGGAAATCCTTTAGATTTTGAACAAAGTGCTGCACAGTGGAACTGGCAGATTT
                      ____________________________________________________________
consensus TTGATCCCGGAAATCCTTTAGATTTTGAACAAAGTGCTGCACAGTGGAACTGGCAGATTT
 
. : . : . : . : . : . :
rJMSF010P14+ GTACGGAGATGATAATGCCAGCAGATGGTAATAATAAGGATAGCATTTTCCCAGCCTCGG
rJMSF032P18+ GTACGGAGATGATAATGCCAGCAGATGGTAATAATAAGGATAGCATTTTCCCAGCCTCGG
rJMSF003A07+ GTACGGAGATGATAATGCCAGCAGATGGTAATAATAAGGATAGCATTTTCCCAGCCTCGG
rJMFF001N17+ GTACGGAGATGATAATGCCAGCAGATGGTAATAATAAGGATAGCATTTTCCCAGCCTCGG
                      ____________________________________________________________
consensus GTACGGAGATGATAATGCCAGCAGATGGTAATAATAAGGATAGCATTTTCCCAGCCTCGG
 
. : . : . : . : . : . :
rJMSF010P14+ AATGGGACTACAATGGAAGGGTCCAATTTTGCAAAGACACCTTCAAAATTGAGCCCAGGC
rJMSF032P18+ AATGGGACTACAATGGAAGGGTCCAATTTTGCAAAGACACCTTCAAAATTGAGCCCAGGC
rJMSF003A07+ AATGGGACTACAATGGAAGGGTCCAATTTTGCAAAGACACCTTCAAAATTGAGCCCAGGC
rJMFF001N17+ AATGGGACTACAATGGAAGGGTCCAATTTTGCAAAGACACCTTCAAAATTGAGCCCAGGC
                      ____________________________________________________________
consensus AATGGGACTACAATGGAAGGGTCCAATTTTGCAAAGACACCTTCAAAATTGAGCCCAGGC
 
. : . : . : . : . : . :
rJMSF010P14+ CCAATTGGATTACCACGGAGTTCGGGGGCCACAACATTGAGAGGGTTTTAAAAAAGTTTG
rJMSF032P18+ CCAATTGGATTACCACGGAGTTCGGGGGCCACAACATTGAGAGGGTTTTAAAAAAGTTTG
rJMSF003A07+ CCAATTGGATTACCACGGAGTTCGGGGGCCACAACATTGAGAGGGTTTTAAAAAAGTTTG
rJMFF001N17+ CCAATTGGATTACCACGGAGTTCGGGGGCCACAACATTGAGAGGGTTTTAAAAAAGTTTG
                      ____________________________________________________________
consensus CCAATTGGATTACCACGGAGTTCGGGGGCCACAACATTGAGAGGGTTTTAAAAAAGTTTG
 
. : . : . : . : . : . :
rJMSF010P14+ GTAGCAACATCATCTTCTTTAACGGATTGAGGGATCCATGGAGTGCAGGAGGGGTGTTAA
rJMSF032P18+ GTAGCAACATCATCTTCTTTAACGGATTGAGGGATCCATGGAGTGCAGGAGGGGTGTTAA
rJMSF003A07+ GTAGCAACATCATCTTCTTTAACGGATTGAGGGATCCATGGAGTGCAGGAGGGGTGTTAA
rJMFF001N17+ GTAGCAACATCATCTTCTTTAACGGATTGAGGGATCCATGGAGTGCAGGAGGGGTGTTAA
                      ____________________________________________________________
consensus GTAGCAACATCATCTTCTTTAACGGATTGAGGGATCCATGGAGTGCAGGAGGGGTGTTAA
 
. : . : . : . : . : . :
rJMSF010P14+ AAAGTATCTCTAAATCTTTAGTTGCTATCACTGCAAAAGAAGGTGCGCATCATGTGGACC
rJMSF032P18+ AAAGTATCTCTAAATCTTTAGTTGCTATCACTGCAAAAGAAGGTGCGCATCATGTGGACC
rJMSF003A07+ AAAGTATCTCTAAATCTTTAGTTGCTATCACTGCAAAAGAAGGTGCGCATCATGTGGACC
rJMFF001N17+ AAAGTATCTCTAAATCTTTAGTTGCTATCACTGCAAAAGAAGGTGCGCATCATGTGGACC
                      ____________________________________________________________
consensus AAAGTATCTCTAAATCTTTAGTTGCTATCACTGCAAAAGAAGGTGCGCATCATGTGGACC
 
. : . : . : . : . : . :
rJMSF010P14+ TTAAATTCTCAACAAAGGAAGATCCAAAATGGCTAAAAGATGTGAGGAGGAAGGAGGTAG
rJMSF032P18+ TTAAATTCTCAACAAAGGAAGATCCAAAATGGCTAAAAGATGTGAGGAGGAAGGAGGTAG
rJMSF003A07+ TTAAATTCTCAACAAAGGAAGATCCAAAATGGCTAAAAGATGTGAGGAGGAAGGAGGTAG
rJMFF001N17+ TTAAATTCTCAACAAAGGAAGATCCAAAATGGCTAAAAGATGTGAGGAGGAAGGAGGTAG
rJMSF041K06- AAGGAAGATCCAAAATGGCTAAAAGATGTGAGGAGGAAGGAGGTAG
rJMSF007C19- AAGGAAGATCC-AAATGGCTAAAAGATGTGAGGAGGAAGGAGGTAG
                      ____________________________________________________________
consensus TTAAATTCTCAACAAAGGAAGATCCAAAATGGCTAAAAGATGTGAGGAGGAAGGAGGTAG
 
. : . : . : . : . : . :
rJMSF010P14+ AAATCATACAGGAATGGATCTCTCAATATTATCAT
rJMSF032P18+ AAATCATACAGGAATGGATCTCTCAATATTATCATTATTGATTGGGTTTTTCAATTTGAA
rJMSF003A07+ AAATCATACAGGAATGGATCTCTCAATATTATCATTATTGATTGGGTTTTTCAATTTGAA
rJMFF001N17+ AAATCATACAGGAATGGATCTCTCAATATTATCATTATTGATTGGGTTTTTCAA-TTGAA
rJMSF041K06- AAATCATACAGGAATGGATCTCTCAATATTATCATTATTGATTGGGTTTTTCAATTTGAA
rJMSF007C19- AAATCATACAGGAATGGATCTCTCAATATTATCATTATTGATTGGGTTTTTCAATTTGAA
                      ____________________________________________________________
consensus AAATCATACAGGAATGGATCTCTCAATATTATCATTATTGATTGGGTTTTTCAATTTGAA
 
. : . : . : . : . : . :
rJMSF032P18+ C
rJMSF003A07+ CCAAGACAGTGT
rJMFF001N17+ -CAAGACAGTG-TGAGAACGTGA-GTATCATCAANAAAAAAA
rJMSF041K06- -CAAGACAGTGTTGAGAACGTGATGTATCATCAATAAAAAAAATACTTAAAGACATTGAC
rJMSF007C19- -CAAGACAGTGTTGAGAACGTGATGTATCATCAATAAAAAAAATACTTAAAGACATTGAC
                      ____________________________________________________________
consensus -CAAGACAGTGTTGAGAACGTGATGTATCATCAATAAAAAAAATACTTAAAGACATTGAC
 
. : . : . : . : . : . :
rJMSF041K06- AAATGTGTTACATTGTCACCCTACTTATCACCAATGTTACATCATTATTTTTATGTTTTT
rJMSF007C19- AAATGTGTTACATTGTCACCCTACTTATCACCAATGTTACATCATTATTTTTATGTTTTT
                      ____________________________________________________________
consensus AAATGTGTTACATTGTCACCCTACTTATCACCAATGTTACATCATTATTTTTATGTTTTT
 
. : . : . : . : . : . :
rJMSF041K06- CTTTAATCTTTGATTTACGTGGTAATTCACACTCACTATTTGGATATGCACTTTGGGTGA
rJMSF007C19- CTTTAATCTTTGATTTACGTGGTAATTCACACTCACTATTTGGATATGCACTTTGGGTGA
                      ____________________________________________________________
consensus CTTTAATCTTTGATTTACGTGGTAATTCACACTCACTATTTGGATATGCACTTTGGGTGA
 
. : . : . : . : . : . :
rJMSF041K06- CACCTGATTTGTAGTGTTATTGGCAAAGAACTACAATGAGTAGTTAAGCTTGTTTAGGTT
rJMSF007C19- CACCTGATTTGTAGTGTTATTGGCAAAGAACTACAATGAGTAGTTAAGCTTGTTTAGGTT
                      ____________________________________________________________
consensus CACCTGATTTGTAGTGTTATTGGCAAAGAACTACAATGAGTAGTTAAGCTTGTTTAGGTT
 
. : . : . : . : . : . :
rJMSF041K06- ATCCCTGATCGTCTCAAATAAAAAAGGTCGATGTATAGACAACTCCAATAAAGAGTCAAA
rJMSF007C19- ATCCCTGATCGTCTCAAATAAAAAAGGTCGATGTATAGACAACTCCAATAAAGAGTCAAA
                      ____________________________________________________________
consensus ATCCCTGATCGTCTCAAATAAAAAAGGTCGATGTATAGACAACTCCAATAAAGAGTCAAA
 
. : . : . : . : . : . :
rJMSF041K06- CTTGAAACCGGTTTAAAGTATAATGTTATCCCTTACCAAAATACTTGAGATTTTTCGTTG
rJMSF007C19- CTTGAAACCGGTTTAAAGTATAATGTTATCCCTTACCAAAATACTTGAGATTTTTCGTTG
                      ____________________________________________________________
consensus CTTGAAACCGGTTTAAAGTATAATGTTATCCCTTACCAAAATACTTGAGATTTTTCGTTG
 
. : . : . : . : . : . :
rJMSF041K06- CATATTATACAAGTTGCTAGGGCAGCTGTTGTGTAAATGCTATATATATGTGGTGCATAA
rJMSF007C19- CATATTATACAAGTTGCTAGGGCAGCTGTTGTGTAAATGCTATATATATGTGGTGCATAA
                      ____________________________________________________________
consensus CATATTATACAAGTTGCTAGGGCAGCTGTTGTGTAAATGCTATATATATGTGGTGCATAA
 
. : . : . : . : . : . :
rJMSF041K06- TCATGACTCGCGAGGCCGTCAACAAAATAATATTACAAATTTCATAACAAAAATAAATAA
rJMSF007C19- TCATGACTCGCGAGGCCGTCAACAAAATAATATTACAAATTTCATAACAAAAATAAATAA
                      ____________________________________________________________
consensus TCATGACTCGCGAGGCCGTCAACAAAATAATATTACAAATTTCATAACAAAAATAAATAA
 
. : . : . : . : . : . :
rJMSF041K06- TGCCACATCAAACTCTCG-AAAAAGTGTGTTAGAGTTGATCGATTGCTGTTGATACGTGT
rJMSF007C19- TGCCACATCAAACTCTCGAAAAAAGTGTGTTAGAGTTGATCGATTGCTGTTGATACGTGT
                      ____________________________________________________________
consensus TGCCACATCAAACTCTCGAAAAAAGTGTGTTAGAGTTGATCGATTGCTGTTGATACGTGT
 
. : . : . : . : . : . :
rJMSF041K06- AATTTAACTTAGAAGCTATC
rJMSF007C19- AATTTAACTTAGAAGCTATCAAGAGTAACAATTTGTAAACACATAGCAAATATCAATCAA
                      ____________________________________________________________
consensus AATTTAACTTAGAAGCTATCAAGAGTAACAATTTGTAAACACATAGCAAATATCAATCAA
 
. : . : . : . : . : . :
rJMSF007C19- TCAAGAATAGTATACCATAACCCATGGAGTAAAGAACAAAACTAGCAACATCATAAGTCA
                      ____________________________________________________________
consensus TCAAGAATAGTATACCATAACCCATGGAGTAAAGAACAAAACTAGCAACATCATAAGTCA