Previous Contig 011360:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007B18Sequence298011360 (6)pir|T06480|T064807e-13safener-induced In2.1-like protein - wheat>gb:TAE17386_1724277 Triticum aestivum783011360 (6)gb:AB087837_15247214e-66Pisum sativum GST mRNA for glutathione S-transferase, partial cds.
JMSF015N21Sequence485011360 (6)gb:AC084405_17336114e-44Oryza sativa chromosome 3 BAC OSJNBa0044H10 genomic sequence, complete sequence.775011360 (6)gb:AB087837_15247212e-77Pisum sativum GST mRNA for glutathione S-transferase, partial cds.
JMSF036A09Sequence676011360 (6)gb:AC084405_17336113e-66Oryza sativa chromosome 3 BAC OSJNBa0044H10 genomic sequence, complete sequence.787011360 (6)gb:AF249913_17807916e-70Glycine max In2-1 protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF007B18- AAGAAAAGAGTGGAAGC
JMSF015N21- GGTTTCCAAATCGTTTGTTTCGTTGATGAAAGCAAAAGCAAGAAAAGAGTGGAAGC
JMSF036A09- C
                      ____________________________________________________________
consensus GGTTTCCAAATCGTTTGTTTCGTTGATGAAAGCAAAAGCAAGAAAAGAGTGGAAGC
 
. : . : . : . : . : . :
JMSF007B18- TATCATCTCCATCGCAATAATGTCACTCTGCTTTCAACTTCCCTCCAAATTCCCACTCAA
JMSF015N21- TATCATCTCCATCGCAATAATGTCACTCTGCTTTCAACTTCCCTCCAAATTCCCACTCAA
JMSF036A09- TATCATCTCCATCGCAATAATGTCACTCTGCTTTCAACTTCCCTCCAAATTCCCACTCAA
                      ____________________________________________________________
consensus TATCATCTCCATCGCAATAATGTCACTCTGCTTTCAACTTCCCTCCAAATTCCCACTCAA
 
. : . : . : . : . : . :
JMSF007B18- TATTCACCTCCGATGCTCCAAACCCACTCCAACATCACTCTCAGTCACGGCTTCAAGAAG
JMSF015N21- TATTCACCTCCGATGCTCCAAACCCACTCCAACATCACTCTCAGTCACGGCTTCAAGAAG
JMSF036A09- TATTCACCTCCGATGCTCCAAACCCACTCCAACATCACTCTCAGTCACGGCTTCAAGAAG
                      ____________________________________________________________
consensus TATTCACCTCCGATGCTCCAAACCCACTCCAACATCACTCTCAGTCACGGCTTCAAGAAG
 
. : . : . : . : . : . :
JMSF007B18- TGAGGTGCTTCCTCCTGCTCTGGATTCATCCTCAGAACCACCGCCAATCTTTGATGGAAT
JMSF015N21- TGAGGTGCTTCCTCCTGCTCTGGATTCATCCTCAGAACCACCGCCAATCTTTGATGGAAT
JMSF036A09- TGAGGTGCTTCCTCCTGCTCTGGATTCATCCTCAGAACCACCGCCAATCTTTGATGGAAT
rJMSF036A09+ TCATCNTCAGAACCACCGCCCATCTTTGATGGAAT
rJMSF015N21+ GATGGAAT
                      ____________________________________________________________
consensus TGAGGTGCTTCCTCCTGCTCTGGATTCATCCTCAGAACCACCGCCAATCTTTGATGGAAT
 
. : . : . : . : . : . :
JMSF007B18- TCCAAAGCTATACATTTC-TTACTCATGCCCATATGCACAACGTCCATGGATTGNCCGCA
JMSF015N21- TCCAAAGCTATACATTTC-TTACTCATGCCCATATGCACAACGTCCATGGATTGCCCGCA
JMSF036A09- TCCAAAGCTATACATTTC-TTACTCATGCCCATATGCACAACGTCCATGGATTGCCCGCA
rJMSF036A09+ TCCNAAGCTATACATTTCTTTACTCATGCCCATATGCACAACGTCCATGGATTGCCCGCA
rJMSF015N21+ TCCAAAGCTATACATTTC-TTACTCATGCCCATATGCACAACGTCCATGGATTGCCCGCA
                      ____________________________________________________________
consensus TCCAAAGCTATACATTTC-TTACTCATGCCCATATGCACAACGTCCATGGATTGCCCGCA
 
. : . : . : . : . : . :
JMSF007B18- ACTG
JMSF015N21- ACTGTAAGGGATTACAGGACACGATAAAACTGGTCCCGATTGACTTAAAGAACAGGCCAG
JMSF036A09- ACT-----GGATTACAGGACACGATAAAACTGGTCCCGATTGACTTAAAGAACAGGCCAG
rJMSF036A09+ ACT-----GGATTACAGGACACGATAAAACTGGTCCCGATTGACTTAAAGAACAGGCCAG
rJMSF015N21+ ACTGTAAGGGATTACAGGACACGATAAAACTGGTCCCGATTGACTTAAAGAACAGGCCAG
rJMSF007B18+ GGATTACAGGACACGATAAAACTGGTCCCGATTGACTTAAAGAACAGGCCAG
                      ____________________________________________________________
consensus ACTGTAAGGGATTACAGGACACGATAAAACTGGTCCCGATTGACTTAAAGAACAGGCCAG
 
. : . : . : . : . : . :
JMSF015N21- CTTGGTACAAGGAAAAGGTTTATCCGGCTAACAAGGTGCCGGCTCTGGAACACAATAATG
JMSF036A09- CTTGGTACAAGGAAAAGGTTTATCCGGCTAACAAGGTGCCGGCTCTGGAACACAATAATG
rJMSF036A09+ CTTGGTACAAGGAAAAGGTTTATCCGGCTAACAAGGTGCCGGCTCTGGAACACAATAATG
rJMSF015N21+ CTTGGTACAAGGAAAAGGTTTATCCGGCTAACAAGGTGCCGGCTCTGGAACACAATAATG
rJMSF007B18+ CTTGGTACAAGGAAAAGGTTTATCCGGCTAACAAGGTGCCGGCTCTGGAACACAATAATG
                      ____________________________________________________________
consensus CTTGGTACAAGGAAAAGGTTTATCCGGCTAACAAGGTGCCGGCTCTGGAACACAATAATG
 
. : . : . : . : . : . :
JMSF015N21- AAGTTAAGGGAGAAAGTCTTGATTTAATTAAATATATCGACAGTAACTTTGAAGGGCCTT
JMSF036A09- AAGTTAAGGGAGAAAGTCTTGATTTAATTAAATATATCGACAGTAACTTTGAAGGGCCTT
rJMSF036A09+ AAGTTAAGGGAGAAAGTCTTGATTTAATTAAATATATCGACAGTAACTTTGAAGGGCCTT
rJMSF015N21+ AAGTTAAGGGAGAAAGTCTTGATTTAATTAAATATATCGACAGTAACTTTGAAGGGCCTT
rJMSF007B18+ AAGTTAAGGGAGAAAGTCTTGATTTAATTAAATATATCGACAGTAACTTTGAAGGGCCTT
                      ____________________________________________________________
consensus AAGTTAAGGGAGAAAGTCTTGATTTAATTAAATATATCGACAGTAACTTTGAAGGGCCTT
 
. : . : . : . : . : . :
JMSF015N21- CTCTCTTTCC
JMSF036A09- CTCTCTTTCCGGATGATCCTTCCAAGAGAGAATTTTCCGAGGAATTGCTATCACACCTTG
rJMSF036A09+ CTCTCTTTCCGGATGATCCTTCCAAGAGAGAATTTTCCGAGGAATTGCTATCACACCTTG
rJMSF015N21+ CTCTCTTTCCGGATGATCCTTCCAAGAGAGAATTTTCCGAGGAATTGCTATCACACCTTG
rJMSF007B18+ CTCTCTTTCCGGATGATCCTTCCAAGAGAGAATTTTCCGAGGAATTGCTATCACACCTTG
                      ____________________________________________________________
consensus CTCTCTTTCCGGATGATCCTTCCAAGAGAGAATTTTCCGAGGAATTGCTATCACACCTTG
 
. : . : . : . : . : . :
JMSF036A09- ACACATTTTACAAAACTGTAACTTCTTATTTCAAGGGAGAGAAGGAAGATGTCGGCGCTG
rJMSF036A09+ ACACATTTTACAAAACTGTAACTTCTTATTTCAAGGGAGAGAAGGAAGATGTCGGCGCTG
rJMSF015N21+ ACACATTTTACAAAACTGTAACTTCTTATTTCAAGGGAGAGAAGGAAGATGTCGGCGCTG
rJMSF007B18+ ACACATTTTACAAAACTGTAACTTCTTATTTCAAGGGAGAGAAGGAAGATGTCGGCGCTG
                      ____________________________________________________________
consensus ACACATTTTACAAAACTGTAACTTCTTATTTCAAGGGAGAGAAGGAAGATGTCGGCGCTG
 
. : . : . : . : . : . :
JMSF036A09- CTTTCGACTCTATTGAGACCGCTCTTTCTAAACATGGAGATGGACCTTTTTTCCTTGGCC
rJMSF036A09+ CTTTCGACTCTATTGAGACCGCTCTTTCTAAACATGGAGATGGACCTTTTTTCCTTGGCC
rJMSF015N21+ CTTTCGACTCTATTGAGACCGCTCTTTCTAAATATGGAGATGGACCTTTTTTCCTTGGCC
rJMSF007B18+ CTTTCGACTCTATTGAGACCGCTCTTTCTAAATATGGAGATGGACCTTTTTTCCTTGGCC
                      ____________________________________________________________
consensus CTTTCGACTCTATTGAGACCGCTCTTTCTAAACATGGAGATGGACCTTTTTTCCTTGGCC
 
. : . : . : . : . : . :
JMSF036A09- AGTTCAGTCTTGTAGATATAGCTTATGTGCCATTCGTTGAAAGATTCCAGCTTTTCTTAC
rJMSF036A09+ AGTTCAGTCTTGTAGATATAGCTTATGTGCCATTCGTTGAAAGATTCCAGCTTTTCTTAC
rJMSF015N21+ AGTTCAGTCTTGTAGATATAGCTTATGTGCCATTCGTTGAAAGATTCCAGCTTTTCTTAC
rJMSF007B18+ AGTTCAGTCTTGTAGATATAGCTTATGTGCCATTCGTTGAAAGATTCCAGCTTTTCTTAC
                      ____________________________________________________________
consensus AGTTCAGTCTTGTAGATATAGCTTATGTGCCATTCGTTGAAAGATTCCAGCTTTTCTTAC
 
. : . : . : . : . : . :
JMSF036A09- TAGAAGTAAAGAGTTACGA
rJMSF036A09+ TAGAAGTAAAGAGTTACGATATTACAACAGGCAGGCCAAAACTTGCAGCCTGGATTGAGG
rJMSF015N21+ TAGAAGTAAAGAGTTACGATATTACAACAGGCAGGCCAAAACTTGCAGCCTGGATTGAGG
rJMSF007B18+ TAGAAGTAAAGAGTTACGATATTACAACAGGCAGGCCAAAACTTGCAGCCTGGATTGAGG
                      ____________________________________________________________
consensus TAGAAGTAAAGAGTTACGATATTACAACAGGCAGGCCAAAACTTGCAGCCTGGATTGAGG
 
. : . : . : . : . : . :
rJMSF036A09+ AGATGAACCAAATTGAGGGGTACAAAGTAACAAAAAGAGATCCAAATGAGCTTGTGGAAG
rJMSF015N21+ AGATGAACCAAATTGAGGGCTACAAAGTAACAAAAAGAGATCCAAATGAGCTTGTGGAAG
rJMSF007B18+ AGATGAACCAAATTGAGGGGTACAAAGTAACAAAAAGAGATCCAAATGAGCTTGTGGAAG
                      ____________________________________________________________
consensus AGATGAACCAAATTGAGGGGTACAAAGTAACAAAAAGAGATCCAAATGAGCTTGTGGAAG
 
. : . : . : . : . : . :
rJMSF036A09+ GCTATAAGAAGCGATATTCGTCTTAGCCCTGGCTGAAGATGAAGACGACGAGTAGCTCTT
rJMSF015N21+ GCTATAAGAAGCGATATTCGTCTTAGCCCTGGCTGAAGATGAAGACGACGAGTAGCTCTT
rJMSF007B18+ GCTATAAGAAGCGATATTCGTCTTAGCCCTGGCTGAAGATGAAGACGACGAGTAGCTCTT
                      ____________________________________________________________
consensus GCTATAAGAAGCGATATTCGTCTTAGCCCTGGCTGAAGATGAAGACGACGAGTAGCTCTT
 
. : . : . : . : . : . :
rJMSF036A09+ ATTCTCATAACTCACGCTATAAGAGGATCACTGTAAGTACCAGTCCCCGGGGGGGAAAAG
rJMSF015N21+ ATTCTCATAACTCACGCTATAAGAGGATCACTGTAAGTA-CAGTCCCCGGGGGGGAAAAG
rJMSF007B18+ ATTCTCATAACTCACGCTATAAGAGGATCACTGTAAGTA-CAGTCCCCGGGGGGGAAAAG
                      ____________________________________________________________
consensus ATTCTCATAACTCACGCTATAAGAGGATCACTGTAAGTA-CAGTCCCCGGGGGGGAAAAG
 
. : . : . : . : . : . :
rJMSF036A09+ AATGAGAACATTATGTATGGAGAGTTGTAGAAT
rJMSF015N21+ AATGAGAACATTATGTATGGAGAGTTGTAGAATTGAATTGAGTTTT
rJMSF007B18+ AATGAGAACATTATGTATGGAGAGTTGTAGAATTGAATTGAGTTTTTTGTTCCAACTCCG
                      ____________________________________________________________
consensus AATGAGAACATTATGTATGGAGAGTTGTAGAATTGAATTGAGTTTTTTGTTCCAACTCCG
 
. : . : . : . : . : . :
rJMSF007B18+ ATCAATTTTTTATATTGGTAGCAGATGCAAATCTATACTGATTTTATATGATGTTTATAG
                      ____________________________________________________________
consensus ATCAATTTTTTATATTGGTAGCAGATGCAAATCTATACTGATTTTATATGATGTTTATAG