Previous Contig 011359:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007B17Sequence251011359 (4)gb:AK175183_18171714e-14Arabidopsis thaliana mRNA for ribosomal protein-like, complete cds, clone: RAFL2756011359 (4)gb:AK175183_18171712e-73Arabidopsis thaliana mRNA for ribosomal protein-like, complete cds, clone: RAFL2
JMSF047J20Sequence726011359 (4)gb:AK175183_18171712e-73Arabidopsis thaliana mRNA for ribosomal protein-like, complete cds, clone: RAFL2755011359 (4)gb:AK175183_18171712e-73Arabidopsis thaliana mRNA for ribosomal protein-like, complete cds, clone: RAFL2

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF007B17- GGGTGAATTCTTTGCTGATTTACATACAGTTCCGAGGTAACTAGAATCGTAGAA
rJMSF047J20+ TTTACATACAGTTCCGAGGTAACTAGAATCGTAGAA
rJMSF007B17+ TTTACATACAGTTCCGAGGTAACTAGAATCGTAGAA
                      ____________________________________________________________
consensus GGGTGAATTCTTTGCTGATTTACATACAGTTCCGAGGTAACTAGAATCGTAGAA
 
. : . : . : . : . : . :
JMSF007B17- AGATGAGGAAGCTGAAGTTTCATGAGAAGAAGCTGGTGAAGAAGGCGAACTTTCTAGAAT
rJMSF047J20+ AGATGAGGAAGCTGAAGTTTCATGAGAAGAAGCTGGTGAAGAAGGCGAACTTTCTAGAAT
rJMSF007B17+ AGATGAGGAAGCTGAAGTTTCATGAGAAGAAGCTGGTGAAGAAGGCGAACTTTCTAGAAT
                      ____________________________________________________________
consensus AGATGAGGAAGCTGAAGTTTCATGAGAAGAAGCTGGTGAAGAAGGCGAACTTTCTAGAAT
 
. : . : . : . : . : . :
JMSF007B17- GGAAGAGAGAGCATGGCCACCGAGAAGCTCTTGTTATGCATCGCTACCACGTCACAGGAA
rJMSF047J20+ GGAAGAGAGAGCATGGCCACCGAGAAGCTCTTGTTATGCATCGCTACCACGTCACAGGAA
rJMSF007B17+ GGAAGAGAGAGCATGGCCACCGAGAAGCTCTTGTTATGCATCGCTACCACGTCACAGGAA
                      ____________________________________________________________
consensus GGAAGAGAGAGCATGGCCACCGAGAAGCTCTTGTTATGCATCGCTACCACGTCACAGGAA
 
. : . : . : . : . : . :
JMSF007B17- GAGACGACTACCAGAAGTACTCAGGATTGTGTAGAATGACACAGAAGCTGGTGAATATAC
rJMSF047J20+ GAGACGACTACAAGAAGTACTCAGGATTGTGTAGAATGACACAGAAGCTGGTGAATATAC
JMSF047J20- GGATTGTGTAGAATGACACAGAAGCTGGTGAATATAC
rJMSF007B17+ GAGACGACTACAAGAAGTACTCAGGATTGTGTAGAATGACACAGAAGCTGGTGAATATAC
                      ____________________________________________________________
consensus GAGACGACTACAAGAAGTACTCAGGATTGTGTAGAATGACACAGAAGCTGGTGAATATAC
 
. : . : . : . : . : . :
JMSF007B17- TGAAGCNAATGGACGCA
rJMSF047J20+ TGAAGCAAATGGACGCAAGAGATCCGTTTCGTATTGAAATGACCGATGCCCTTCTCGAAA
JMSF047J20- TGAAGCAAATGGACGCAAGAGATCCGTTTCGTATTGAAATGACCGATGCCCTTCTCGAAA
rJMSF007B17+ TGAAGCAAATGGACGCAAGAGATCCGTTTCGTATTGAAATGACCGATGCCCTTCTCGAAA
                      ____________________________________________________________
consensus TGAAGCAAATGGACGCAAGAGATCCGTTTCGTATTGAAATGACCGATGCCCTTCTCGAAA
 
. : . : . : . : . : . :
rJMSF047J20+ AGCTGTATAACATGGGTGTGATATCAGAACGGAAAAGTTTAGCATTGTGTGATAAGCTAT
JMSF047J20- AGCTGTATAACATGGGTGTGATATCAGAACGGAAAAGTTTAGCATTGTGTGATAAGCTAT
rJMSF007B17+ AGCTGTATAACATGGGTGTGATATCAGAACGGAAAAGTTTAGCATTGTGTGATAAGCTAT
                      ____________________________________________________________
consensus AGCTGTATAACATGGGTGTGATATCAGAACGGAAAAGTTTAGCATTGTGTGATAAGCTAT
 
. : . : . : . : . : . :
rJMSF047J20+ CAGTTTCATCCTTCTGTAGGCGTAGACTCTCCACTGTCTTGGTCAAGCTAAAGTTTGCTG
JMSF047J20- CAGTTTCATCCTTCTGTAGGCGTAGACTCTCCACTGTCTTGGTCAAGCTAAAGTTTGCTG
rJMSF007B17+ CAGTTTCATCCTTCTGTAGGCGTAGACTCTCCACTGTCTTGGTCAAGCTAAAGTTTGCTG
                      ____________________________________________________________
consensus CAGTTTCATCCTTCTGTAGGCGTAGACTCTCCACTGTCTTGGTCAAGCTAAAGTTTGCTG
 
. : . : . : . : . : . :
rJMSF047J20+ AACACTTGAAGGAAGCTGTGACATATATAGAACAGGGGCATATTCGAGTTGGACCAGATA
JMSF047J20- AACACTTGAAGGAAGCTGTGACATATATAGAACAGGGGCATATTCGAGTTGGACCAGATA
rJMSF007B17+ AACACTTGAAGGAAGCTGTGACATATATAGAACAGGGGCATATTCGAGTTGGACCAGATA
                      ____________________________________________________________
consensus AACACTTGAAGGAAGCTGTGACATATATAGAACAGGGGCATATTCGAGTTGGACCAGATA
 
. : . : . : . : . : . :
rJMSF047J20+ CCATTACTGATCCAGCATTTCTGGTTACAAGAAATATGGAAGACTTTATTACATGGGTGG
JMSF047J20- CCATTACTGATCCAGCATTTCTGGTTACAAGAAATATGGAAGACTTTATTACATGGGTGG
rJMSF007B17+ CCATTACTGATCCAGCATTTCTGGTTACAAGAAATATGGAAGACTTTATTACATGGGTGG
                      ____________________________________________________________
consensus CCATTACTGATCCAGCATTTCTGGTTACAAGAAATATGGAAGACTTTATTACATGGGTGG
 
. : . : . : . : . : . :
rJMSF047J20+ ATACTTCAAAGATAAGAAGAAAGGTCTTAGAGTACAATGAGAAGTTGGATGACTATGATG
JMSF047J20- ATACTTCAAAGATAAGAAGAAAGGTCTTAGAGTACAATGAGAAGTTGGATGACTATGATG
rJMSF007B17+ ATACTTCAAAGATAAGAAGAAAGGTCTTAGAGTACAATGAGAAGTTGGATGACTATGATG
                      ____________________________________________________________
consensus ATACTTCAAAGATAAGAAGAAAGGTCTTAGAGTACAATGAGAAGTTGGATGACTATGATG
 
. : . : . : . : . : . :
rJMSF047J20+ CTTTGAACTCGTGAATCCATGAGGACACTCCAAAAAACCACACTGAAATTTTAGTGGTTT
JMSF047J20- CTTTGAACTCGTGAATCCATGAGGACACTCCAAAAAACCACACTGAAATTTTAGTGGTTT
rJMSF007B17+ CTTTGAACTCGTGAATCCATGAGGACACTCCAAAAAACCACACTGAAATTTTAGTGGTTT
                      ____________________________________________________________
consensus CTTTGAACTCGTGAATCCATGAGGACACTCCAAAAAACCACACTGAAATTTTAGTGGTTT
 
. : . : . : . : . : . :
rJMSF047J20+ TTCTTATTCCTTTTCATCATGTAATCTTACTCAGAAGTGCTTTCTTCTTGGCGGCTCTCA
JMSF047J20- TTCTTATTCCTTTTCATCATGTAATCTTACTC
rJMSF007B17+ TTCTTATTCCTTTTCATCATGTAATCTTACTCAGAAGTGCTTTCTTCTTGGCGGCTCTCA
                      ____________________________________________________________
consensus TTCTTATTCCTTTTCATCATGTAATCTTACTCAGAAGTGCTTTCTTCTTGGCGGCTCTCA
 
. : . : . : . : . : . :
rJMSF047J20+ TTGAGGGCTTAGTTAACAAGCCAATGTCCTTATATTTATTACATAAAAAC
rJMSF007B17+ TTGAGGGCTTAGTTAACAAGCCAATGTCCTTATATTTATTACATAAAAACATGTTTGAAT
                      ____________________________________________________________
consensus TTGAGGGCTTAGTTAACAAGCCAATGTCCTTATATTTATTACATAAAAACATGTTTGAAT