Previous Contig 011351:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002A23Sequence290007902 (3)pir|B86359|B863592e-18protein Similar to LeOPT1 [Lycopersicon esculentum] [imported] - Arabidopsis tha725011351 (4)gb:AK175547_18175356e-68Arabidopsis thaliana mRNA for putative peptide transporter PTR2-B, complete cds,
JMSF006M13Sequence372003157 (5)263011351 (4)gb:AP004669_18430095e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P049
JMSF007O15Sequence510011351 (4)pir|F86358|F863581e-52Similar to peptide transporter [imported] - Arabidopsis thaliana>gb:AE005172_891
JMSF049D16Sequence653007902 (3)pir|F86358|F863587e-61Similar to peptide transporter [imported] - Arabidopsis thaliana>gb:AE005172_891734011351 (4)gb:AK175547_18175352e-67Arabidopsis thaliana mRNA for putative peptide transporter PTR2-B, complete cds,

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF002A23+ AAGCAAGGAGCTACAATGGATAGATCTATTGGTTCAA
rJMSF049D16+ AGCAAGGAGCTACAATGGATAGATCTATTGGTTCAA
                      ____________________________________________________________
consensus AAGCAAGGAGCTACAATGGATAGATCTATTGGTTCAA
 
. : . : . : . : . : . :
rJMSF007O15+ GTCGCTA
rJMSF002A23+ TTCTTGAAGTACCAGCTGCCTCATTACAATGTATCATCTGCTTTTCAATTCTNGTCGTTA
rJMSF049D16+ TTCTTGAAGTACCAGCTGCCTCATTACAATGTATCATCTGCTTTTCAATTCTTGTCGTTA
                      ____________________________________________________________
consensus TTCTTGAAGTACCAGCTGCCTCATTACAATGTATCATCTGCTTTTCAATTCTTGTCGTTA
 
. : . : . : . : . : . :
rJMSF007O15+ TGCCNATATACGATCGTATTTTGGTTCCTATTACTCGAGCAATAACCCGGAGACCCTCAG
rJMSF002A23+ TGCCTATATACGACCGTATTTTGGTTCCTATTACTCGAGCAATAACCCGGAGACCCTCAG
rJMSF049D16+ TGCCTATATACGACCGTATTTTGGTTCCTATTACTCGAGCAATAACCCGGAGACCCTCAG
                      ____________________________________________________________
consensus TGCCTATATACGACCGTATTTTGGTTCCTATTACTCGAGCAATAACCCGGAGACCCTCAG
 
. : . : . : . : . : . :
rJMSF007O15+ GGATAACAATGCTTCAAAGAATTGGAACGGGATTAGTTTTTTCTATACTGGCCATGGTGA
rJMSF002A23+ GGATAACAATGCTTCAAAGAATTGGAACGGGATTAGTTTTTTCTATACTGGCCATGGTGA
rJMSF049D16+ GGATAACAATGCTTCAAAGAATTGGAACGGGATTAGTTTTTTCTATACTGGCCATGGTGA
                      ____________________________________________________________
consensus GGATAACAATGCTTCAAAGAATTGGAACGGGATTAGTTTTTTCTATACTGGCCATGGTGA
 
. : . : . : . : . : . :
rJMSF007O15+ TTGCAGCTGTAGTTGAGAAGAAACGTCTTCAAACTGCTTTAGACTACGGGCTGGTTGACT
rJMSF002A23+ TTGCAGCTGTAGTTGAGAAGAAACGTCTTCAAACTGCTTTAGACTACGGGCTGGTTGACT
rJMSF049D16+ TTGCAGCTGTAGTTGAGAAGAAACGTCTTCAAACTGCTTTAGACTACGGGCTGGTTGACT
                      ____________________________________________________________
consensus TTGCAGCTGTAGTTGAGAAGAAACGTCTTCAAACTGCTTTAGACTACGGGCTGGTTGACT
 
. : . : . : . : . : . :
rJMSF007O15+ CGCCAGAGGTAACACTTCCCATTCACGTATTCTGGTTAATNCCACAGTATATATTGGTTG
rJMSF002A23+ CGCCAGAGGTAACACTTCCCATTCACGTATTCTGGTTAATACCACAGTATATATTGGTTG
rJMSF049D16+ CGCCAGAGGTAACACTTCCCATTCACGTATTCTGGTTAATACCACAGTATATATTGGTTG
                      ____________________________________________________________
consensus CGCCAGAGGTAACACTTCCCATTCACGTATTCTGGTTAATACCACAGTATATATTGGTTG
 
. : . : . : . : . : . :
rJMSF007O15+ GCATTTNTGAAGCATTCAGCATGGTCGGTCTGCAAGAGTTCTTNTATGATCAAATGCCTA
rJMSF002A23+ GCATTTCTGAAGCATTCAGCATGGTCGGTCTGCAAGAGTTCTTCTATGATCAAATGCCTA
rJMSF049D16+ GCATTTCTGAAGCATTCAGCATGGTCGGTCTGCAAGAGTTCTTCTATGATCAAATGCCTA
                      ____________________________________________________________
consensus GCATTTCTGAAGCATTCAGCATGGTCGGTCTGCAAGAGTTCTTCTATGATCAAATGCCTA
 
. : . : . : . : . : . :
rJMSF007O15+ GCGAGTTGAAAAGCGTAGGCCTTTCTTTGTACCTCAGTATCTTTGGCATTGGGAGCTTCT
rJMSF002A23+ GCGAGTTGAAAAGCGTAGGCCTTTCTTTGTACCTCAGTATCTTTGGCATTGGGAGCTTCT
rJMSF049D16+ GCGAGTTGAAAAGCGTAGGCCTTTCTTTGTACCTCAGTATCTTTGGCATTGGGAGCTTCT
                      ____________________________________________________________
consensus GCGAGTTGAAAAGCGTAGGCCTTTCTTTGTACCTCAGTATCTTTGGCATTGGGAGCTTCT
 
. : . : . : . : . : . :
rJMSF007O15+ TAAGCAGCTTTCTGATTTCTATTATTGACCATGCCACTGGNGGAGATGGGCAAGACAGTT
rJMSF002A23+ TAAGCAGCTTTCTGATTTCTATTATTGACCATGCCACTGGTGGAGATGGGCAAGACAGTT
rJMSF049D16+ TAAGCAGCTTTCTGATTTCTATTATTGACCATGCCACTGGTGGAGATGGGCAAGACAGTT
rJMSF006M13+ GGAGATGGNCAAGACAGTT
                      ____________________________________________________________
consensus TAAGCAGCTTTCTGATTTCTATTATTGACCATGCCACTGGTGGAGATGGGCAAGACAGTT
 
. : . : . : . : . : . :
rJMSF007O15+ GGTTCTCAGATAACTTGAACCGGGGGCATCTCGACTACTTCTATTGGCTTGTTGCAGGAC
rJMSF002A23+ GGTTCTCAGATAACTTGAACCGGGGGCATCTCGACTACTTCTATTGGCTTGTTGCAGGAC
rJMSF049D16+ GGTTCTCAGATAACTTGAACCGGGGGCATCTCGACTACTTCTATTGGCTTGTTGCAGGAC
rJMSF006M13+ GGTTNTCAGATNACTTGAACCGGGGGCATCTCGACTACTTCTATTGGCTTGTTGCAGGAC
                      ____________________________________________________________
consensus GGTTCTCAGATAACTTGAACCGGGGGCATCTCGACTACTTCTATTGGCTTGTTGCAGGAC
 
. : . : . : . : . : . :
rJMSF007O15+ TTAGTATGGTAGCATTCGT
rJMSF002A23+ TTAGTATGGTAGCATTCGTTGCATACTTGTACTTCTCAAGATTGTACATCTACAATAAGG
rJMSF049D16+ TTAGTATGGTAGCATTCGTTGCATACTTGTACTTCTCAAGATTGTACATCTACAATAAGG
rJMSF006M13+ TTAGTATGGTAGCATTCGTCGCATACTTGTACTTCTCAAGATTGTACATCTACAATAAGG
                      ____________________________________________________________
consensus TTAGTATGGTAGCATTCGTTGCATACTTGTACTTCTCAAGATTGTACATCTACAATAAGG
 
. : . : . : . : . : . :
rJMSF002A23+ CAAATGTTGCTTGAAATGCATTGGATTGATCATTTATGTTGATTAGGAATAAATATGTAT
rJMSF049D16+ CAAATGTTGCTTGAAATGCATTGGATTGATCATTTATGTTGATTAGGAATAAATATGTAT
rJMSF006M13+ CAAATGTTGCTTGAAATGCATNGGATTGATCATNNATGTTGNTTAGGAATAAATNTGTAT
                      ____________________________________________________________
consensus CAAATGTTGCTTGAAATGCATTGGATTGATCATTTATGTTGATTAGGAATAAATATGTAT
 
. : . : . : . : . : . :
rJMSF002A23+ ATTACCAGTACTTTTTTTAAAAAAAA
rJMSF049D16+ ATTACCAGTACTTTTTTTTAAAAAAAATTAATGTATAT
rJMSF006M13+ ACTA-CAGTAC-TTTTTNTAAAAAAAACTAATGTATATTACAGTATACTNGGGAGNGTTA
                      ____________________________________________________________
consensus ATTACCAGTACTTTTTTTTAAAAAAAATTAATGTATATTACAGTATACTNGGGAGNGTTA