Previous Contig 011345:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006K01Sequence424004125 (2)gb:AY091025_15742554e-23Arabidopsis thaliana unknown protein (At2g20190) mRNA, complete cds.387011345 (2)gb:OSJN00169_16961025e-11Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043L24, complete seque
JMSF026K20Sequence144019437245011345 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF006K01+ TCGGAAAAGCATTTTTACCATACTTGC
                      ____________________________________________________________
consensus TCGGAAAAGCATTTTTACCATACTTGC
 
. : . : . : . : . : . :
rJMSF006K01+ AAGGGCTCAACAGCNCNCAATTGAGGCTAGTGNCAATTTATGCNAACCGGATATCNCAGG
                      ____________________________________________________________
consensus AAGGGCTCAACAGCNCNCAATTGAGGCTAGTGNCAATTTATGCNAACCGGATATCNCAGG
 
. : . : . : . : . : . :
rJMSF026K20+ TTTTTTTTTT
rJMSF006K01+ CCCGAACNGGTACTCCCATAGATGCTACCCAAAATTNGANGAAGGNTTTGTTTTTTTTTT
                      ____________________________________________________________
consensus CCCGAACNGGTACTCCCATAGATGCTACCCAAAATTNGANGAAGGNTTTGTTTTTTTTTT
 
. : . : . : . : . : . :
rJMSF026K20+ TCAATGTCTTGTAGGTGGAGTGAGTCGCCGCCTCTAGTGATTCATAAGGCTTCTCTCATG
rJMSF006K01+ TCAATGTCTTGTAGGTGGAGTGAGTCGCCGCCTCTAGTGATTCATAAGGCTTCTCTCATG
                      ____________________________________________________________
consensus TCAATGTCTTGTAGGTGGAGTGAGTCGCCGCCTCTAGTGATTCATAAGGCTTCTCTCATG
 
. : . : . : . : . : . :
rJMSF026K20+ TATAGCGTGAATGTGCTGTCCTTTTCGAGTGGTAACGTTTTTTATTGGTTTTTTCTCTAA
rJMSF006K01+ TATAGCGTGAATGTGCTGTCCTTTTCGAGTGGTAACGTTTTTTATTGGTTTTTTCTCTAA
                      ____________________________________________________________
consensus TATAGCGTGAATGTGCTGTCCTTTTCGAGTGGTAACGTTTTTTATTGGTTTTTTCTCTAA
 
. : . : . : . : . : . :
rJMSF026K20+ CGTAATTTTTATCTTTCATTTTTCAAATCAGTTAGGTTTTAAAGCAGAGTTGCAACTNTT
rJMSF006K01+ CGTAATTTTTATCTTTCATTTTTCAAATCAGTTAGGTTTTAAAGCAGAGTTGCAACTTTT
                      ____________________________________________________________
consensus CGTAATTTTTATCTTTCATTTTTCAAATCAGTTAGGTTTTAAAGCAGAGTTGCAACTTTT
 
. : . : . : . : . : . :
rJMSF026K20+ ATGTACTCTCNTGAATTCCAAAATCGAACT
rJMSF006K01+ ATGTACTTTCATGAATTCCAAAATCGAACTNAACTTCGTAATCTGANGTTGAAACATGAA
                      ____________________________________________________________
consensus ATGTACTTTCATGAATTCCAAAATCGAACTNAACTTCGTAATCTGANGTTGAAACATGAA