Previous Contig 011344:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006J17Sequence418004819 (3)230011344 (2)
JMSF006J19Sequence508011344 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF006J19+ ATGACTGAGATGCATGGGTCGTCTAATGA
                      ____________________________________________________________
consensus ATGACTGAGATGCATGGGTCGTCTAATGA
 
. : . : . : . : . : . :
rJMSF006J19+ TAATCAAATGAAGGAGTATGTGTCTACTTTGGAGAAAGAGTTAGCTGCAACTAAAGCTCA
                      ____________________________________________________________
consensus TAATCAAATGAAGGAGTATGTGTCTACTTTGGAGAAAGAGTTAGCTGCAACTAAAGCTCA
 
. : . : . : . : . : . :
rJMSF006J19+ ATTGCAAATTCAAAGTGGTACGCAAAAGCCCATGGGATGGGCTTTGTTGCTGTTTTGGAA
                      ____________________________________________________________
consensus ATTGCAAATTCAAAGTGGTACGCAAAAGCCCATGGGATGGGCTTTGTTGCTGTTTTGGAA
 
. : . : . : . : . : . :
rJMSF006J19+ AAATCTTTTGGCAAAGTTCCTGAACAATTTGCTACCTTCCTTAACCAAACATCTCAACCA
                      ____________________________________________________________
consensus AAATCTTTTGGCAAAGTTCCTGAACAATTTGCTACCTTCCTTAACCAAACATCTCAACCA
 
. : . : . : . : . : . :
rJMSF006J19+ CTGGCTGTTGTTGGTCATTGAAGTTTCAACAGTGTTAAATAGTTGATTGAAGTGAACATC
                      ____________________________________________________________
consensus CTGGCTGTTGTTGGTCATTGAAGTTTCAACAGTGTTAAATAGTTGATTGAAGTGAACATC
 
. : . : . : . : . : . :
rJMSF006J19+ ACCCTTAGCAGTTAGCACCACCCAAGGGAGCCATTGGGATATTAGTTATACATTAAGAAA
                      ____________________________________________________________
consensus ACCCTTAGCAGTTAGCACCACCCAAGGGAGCCATTGGGATATTAGTTATACATTAAGAAA
 
. : . : . : . : . : . :
rJMSF006J19+ AGCGGTNCCTGATGAAGGAAGCAAGCACCAATCTTCACAAGGGAGTGGAAAGCAAAATTC
rJMSF006J17+ GAAGGAAGCAAGCACCAATCTTCACACGGGAGTGGAAAGCAAAATTC
                      ____________________________________________________________
consensus AGCGGTNCCTGATGAAGGAAGCAAGCACCAATCTTCACACGGGAGTGGAAAGCAAAATTC
 
. : . : . : . : . : . :
rJMSF006J19+ ATCATCTAGTC
rJMSF006J17+ ATCATCTAGTCTAAACTGAGCGGAGACAACTCTAATTAGTTTCATGTTTTATTTTAATNG
                      ____________________________________________________________
consensus ATCATCTAGTCTAAACTGAGCGGAGACAACTCTAATTAGTTTCATGTTTTATTTTAATNG