Previous Contig 011340:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN007F07Sequence641011340 (2)gb:CAR400860_16452551e-74Cicer arietinum mRNA for tubby-like protein.
JMSF006E14Sequence133018465504011340 (2)gb:AP005323_18506305e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P068

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN007F07- GATGAATTTTCACGAGCCAGCAACACTTATCTTGGGAAGCTGAGGTCTAACTTTCTTGGT
                      ____________________________________________________________
consensus GATGAATTTTCACGAGCCAGCAACACTTATCTTGGGAAGCTGAGGTCTAACTTTCTTGGT
 
. : . : . : . : . : . :
JMFN007F07- ACCAAGTTCACCATATATGATAGCCAACCCACCACACATGATTCAGTGGTTCAGCACACT
                      ____________________________________________________________
consensus ACCAAGTTCACCATATATGATAGCCAACCCACCACACATGATTCAGTGGTTCAGCACACT
 
. : . : . : . : . : . :
JMFN007F07- CAGCTTAGTCGAAGATTCCATTCTAAACAAGTGTCTCCTAGAGGAGTATCTGCTTGTAAC
                      ____________________________________________________________
consensus CAGCTTAGTCGAAGATTCCATTCTAAACAAGTGTCTCCTAGAGGAGTATCTGCTTGTAAC
 
. : . : . : . : . : . :
JMFN007F07- TACAGCATTGCCACTATTTCCTACGAGCTCAATGTCCTTCGCACCAGAGGGCCTAGGAGA
                      ____________________________________________________________
consensus TACAGCATTGCCACTATTTCCTACGAGCTCAATGTCCTTCGCACCAGAGGGCCTAGGAGA
 
. : . : . : . : . : . :
JMFN007F07- ATGCAATGTGTTATGCACTCTATCCCCGTCACCTCTATTCAGGAGGGAGGCACAGCTCCT
rJMSF006E14+ ATTCAGGAGGGAGGCACAGNTCCT
                      ____________________________________________________________
consensus ATGCAATGTGTTATGCACTCTATCCCCGTCACCTCTATTCAGGAGGGAGGCACAGCTCCT
 
. : . : . : . : . : . :
JMFN007F07- ACACCAACATCATTCTCGCAGTTTCTCGATGACAGGCCTTCTCACACACCAGTCTCGAAA
rJMSF006E14+ ACACCAACATCATTCTCGCAGTTTCTCGATGACAGGCNTTNTCACACANCAGTCTCGAAA
                      ____________________________________________________________
consensus ACACCAACATCATTCTCGCAGTTTCTCGATGACAGGCCTTCTCACACACCAGTCTCGAAA
 
. : . : . : . : . : . :
JMFN007F07- GCTAAGGATCCAAACATGGATTCCAGCTCCCCTGGACATTCAGGTTCTCTCGTGCCAGAA
rJMSF006E14+ GNTAAGGATCCAAACATGGATTCCAGCTCCCCTGGACATTCAGGTTCTCTCGTGCCAGAA
                      ____________________________________________________________
consensus GCTAAGGATCCAAACATGGATTCCAGCTCCCCTGGACATTCAGGTTCTCTCGTGCCAGAA
 
. : . : . : . : . : . :
JMFN007F07- CCACCTTCTCAAGAGCCCCTTATGCTTAAAAACAAGGCCCCTCGATGGCACGAACAGTTA
rJMSF006E14+ CCACCTTCTCAAGAGCCCNTTATGCTTAAAAACAAGGCCCCTCGATGGCACGAACAGTTA
                      ____________________________________________________________
consensus CCACCTTCTCAAGAGCCCCTTATGCTTAAAAACAAGGCCCCTCGATGGCACGAACAGTTA
 
. : . : . : . : . : . :
JMFN007F07- CAATGCTGGTGCTTAAATTTTAAAGGCCGTGTCACGGTGGCATCTGTCAAGAATTTTCAG
rJMSF006E14+ CAATGCTGGTGCTTAAATTTTAAAGGCCGTGTCACGGTGGCATCTGTCAAGAATTTTCAG
                      ____________________________________________________________
consensus CAATGCTGGTGCTTAAATTTTAAAGGCCGTGTCACGGTGGCATCTGTCAAGAATTTTCAG
 
. : . : . : . : . : . :
JMFN007F07- CTCGTGGCCGCTGTGGATCCTTCTCACAACATACCCGCTGCAGAACAGGAGAAGGTAATC
rJMSF006E14+ CTCGTGGCCGCTGTGGATCCTTCTCACAACATACCCGCTGCAGAACAGGAGAAGGTAATC
                      ____________________________________________________________
consensus CTCGTGGCCGCTGTGGATCCTTCTCACAACATACCCGCTGCAGAACAGGAGAAGGTAATC
 
. : . : . : . : . : . :
JMFN007F07- CTGCAATTCGGAAAGATTGGAAAAGATATCTTCACCATGGA
rJMSF006E14+ CTGCAATTCGGAAAGATTGGAAAAGATATCTTCACCATGGATTATCGCTACCCGCTCTCC
                      ____________________________________________________________
consensus CTGCAATTCGGAAAGATTGGAAAAGATATCTTCACCATGGATTATCGCTACCCGCTCTCC
 
. : . : . : . : . : . :
rJMSF006E14+ GCTTTCCATGCTTTTGCAATCTGCTTGAGCAGCTTTGACACAAAACCAGCCTGTGAATGA
                      ____________________________________________________________
consensus GCTTTCCATGCTTTTGCAATCTGCTTGAGCAGCTTTGACACAAAACCAGCCTGTGAATGA
 
. : . : . : . : . : . :
rJMSF006E14+ TTTTGCAGGTGGTTTGTAAATGATGAACATCTCTTGCTTTTTGTTGCNTCAGAATCTGAA
                      ____________________________________________________________
consensus TTTTGCAGGTGGTTTGTAAATGATGAACATCTCTTGCTTTTTGTTGCNTCAGAATCTGAA