Previous Contig 011337:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006B14Sequence288004801 (2)gb:AY080790_15684921e-19Arabidopsis thaliana unknown protein (At1g04190) mRNA, complete cds.>gb:AY114043239011337 (2)
JMSF006G12Sequence275000617 (9)pir|D96602|D966022e-20nucleolar protein [imported] - Arabidopsis thaliana>gb:AE005173_893493 Arabidops534011337 (2)gb:AY080790_15684921e-16Arabidopsis thaliana unknown protein (At1g04190) mRNA, complete cds.>gb:AY114043

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF006G12+ GG
                      ____________________________________________________________
consensus GG
 
. : . : . : . : . : . :
rJMSF006G12+ TCAAGGATCAAGGAAATGGAAACATGGTCAAAGTGATGGATTTTTCATTCAATNTGAATC
                      ____________________________________________________________
consensus TCAAGGATCAAGGAAATGGAAACATGGTCAAAGTGATGGATTTTTCATTCAATNTGAATC
 
. : . : . : . : . : . :
rJMSF006G12+ ACCTTCTACACGCAAGCTCTGGTTTATTCCTAGTTCAACTGAGAACGGAAAAATCTTGTG
                      ____________________________________________________________
consensus ACCTTCTACACGCAAGCTCTGGTTTATTCCTAGTTCAACTGAGAACGGAAAAATCTTGTG
 
. : . : . : . : . : . :
rJMSF006G12+ CAGGGATCCGGTGTCTTNGGATATAAGTGTACATGAACTTATTCCTCGCCTGTTCAAGCA
                      ____________________________________________________________
consensus CAGGGATCCGGTGTCTTNGGATATAAGTGTACATGAACTTATTCCTCGCCTGTTCAAGCA
 
. : . : . : . : . : . :
rJMSF006G12+ AATATAGGCAATACTGGTCTGAAGTCTTGGTCAGAACTTATTCTGTGGCTGATGACCTTG
                      ____________________________________________________________
consensus AATATAGGCAATACTGGTCTGAAGTCTTGGTCAGAACTTATTCTGTGGCTGATGACCTTG
 
. : . : . : . : . : . :
rJMSF006G12+ AAAAAACTGGGAGTCCTATGGTTACGTAGACAAGATCCCTGTAATGCTGCTTTGGTACGG
                      ____________________________________________________________
consensus AAAAAACTGGGAGTCCTATGGTTACGTAGACAAGATCCCTGTAATGCTGCTTTGGTACGG
 
. : . : . : . : . : . :
rJMSF006G12+ TGCAAGGTACAAAATTGGAAGACAGCACTACAGCAGCTTCACAACACAGGAATGCGTAGG
rJMSF006B14+ GCAAGGTACAAAATTGGAAGACAGCACTACAGCAGCTTCACAACACAGGAANGNGTAGG
                      ____________________________________________________________
consensus TGCAAGGTACAAAATTGGAAGACAGCACTACAGCAGCTTCACAACACAGGAATGCGTAGG
 
. : . : . : . : . : . :
rJMSF006G12+ ACTCCTACATGTATGCATTATCGAACCTTGGTGAGAGTTTGGGTGAGCTTTTTATGCAGT
rJMSF006B14+ ACTCCTACATGTATGCATTNTCGAACCTTGGTGAGAGTTNGGGTGAGCNTGTTATGCAGT
                      ____________________________________________________________
consensus ACTCCTACATGTATGCATTATCGAACCTTGGTGAGAGTTTGGGTGAGCTTTTTATGCAGT
 
. : . : . : . : . : . :
rJMSF006G12+ NGTGTTTTCATGGCAATTTCACCACTAAGTTTAATT-TTGCAAGTCNGATCT-CTTCTTG
rJMSF006B14+ NGTGTTTTCATGGCAANTTCACCANTAAGTTTAATTNCNGCAAGTCTGATCTGCTTCTNG
                      ____________________________________________________________
consensus NGTGTTTTCATGGCAATTTCACCACTAAGTTTAATTNTTGCAAGTCTGATCTGCTTCTTG
 
. : . : . : . : . : . :
rJMSF006G12+ TATTTGCGAGCCTTGATTGTGACGAATTGCAGATTTAAAAAATT
rJMSF006B14+ TATTTGCGAGCCTTGATTGTGATGAATTGCAGANTTAAAAAATTNGGAATGCTTCAGTTT
                      ____________________________________________________________
consensus TATTTGCGAGCCTTGATTGTGATGAATTGCAGATTTAAAAAATTNGGAATGCTTCAGTTT