Previous Contig 011333:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005O14Sequence253001391 (34)pir|T06407|T064071e-21monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF337011333 (3)gb:AF324984_17864382e-06Arabidopsis thaliana At2g27680 (At2g27680/F15K20.22) mRNA, complete cds.
JMSF015F24Sequence477005541 (3)pir|F84675|F846758e-34hypothetical protein At2g27680 [imported] - Arabidopsis thaliana>gb:AC005824_153744011333 (3)gb:AP005558_18540403e-90Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ11
JMSF017L22Sequence256019042pir|F84675|F846752e-10hypothetical protein At2g27680 [imported] - Arabidopsis thaliana>gb:AC005824_153771011333 (3)gb:AP005558_18540403e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015F24+ AGAAGGTAAGATCAAGACTGTTGCTTTGACTAACTTTGACACGGAGAG
rJMSF017L22+ AGAAGGTAAGATCAAGACTGTTGCTTTGACTAACTTTGACACGGAGAG
                      ____________________________________________________________
consensus AGAAGGTAAGATCAAGACTGTTGCTTTGACTAACTTTGACACGGAGAG
 
. : . : . : . : . : . :
rJMSF015F24+ GTTACAGATAATTTTGGAAAATGGCATCCCAATTGTTAGCAATCAGGTTCAGCATTCTAT
rJMSF017L22+ GTTACAGATAA-TTTGGAAAATGGCATCCCAATTGTTAGCAATCAGGTTCAGCATTCTAT
                      ____________________________________________________________
consensus GTTACAGATAATTTTGGAAAATGGCATCCCAATTGTTAGCAATCAGGTTCAGCATTCTAT
 
. : . : . : . : . : . :
rJMSF015F24+ TGTTGACATGCGTCCTCAACAGAAAATGGCAGAGCTTTGTCAACTATCTGGAGTTAAACT
rJMSF017L22+ TGTTGACATGCGTCCTCAACAGAAAATGGCAGAGCTTTGTCAACTATCTGGAGTTAAACT
                      ____________________________________________________________
consensus TGTTGACATGCGTCCTCAACAGAAAATGGCAGAGCTTTGTCAACTATCTGGAGTTAAACT
 
. : . : . : . : . : . :
rJMSF015F24+ TATAACGTATGGAACTGTAATGGGAGGGTTATTATCGGAGAAATTCCTTGATACCAACTT
rJMSF017L22+ TATAACGTATGGAACTGTAATGGGAGGGTTATTATCGGAGAAATTCCTTGATACCAACTT
                      ____________________________________________________________
consensus TATAACGTATGGAACTGTAATGGGAGGGTTATTATCGGAGAAATTCCTTGATACCAACTT
 
. : . : . : . : . : . :
rJMSF015F24+ AATGATTCCATTCGCTGGTCCTCCATTGAACACTCCCTCGCTGCAGAAGTACAAAAGGAT
rJMSF017L22+ AATGATTCCATTCGCTGGTCCTCCATTGAACACTCCCTCGCTGCAGAAGTACAAAAGGAT
                      ____________________________________________________________
consensus AATGATTCCATTCGCTGGTCCTCCATTGAACACTCCCTCGCTGCAGAAGTACAAAAGGAT
 
. : . : . : . : . : . :
rJMSF015F24+ GGTTGATGCTTGGGGAGGATGGAGCCTCTTCCAAGAGCTGCTTCAGACACTGAAAGCAGT
rJMSF017L22+ GGTTGATGCTTGGGGAGGATGGAGCCTCTTCCAAGAGCTGCTTCAGACACTGAAAGCAGT
                      ____________________________________________________________
consensus GGTTGATGCTTGGGGAGGATGGAGCCTCTTCCAAGAGCTGCTTCAGACACTGAAAGCAGT
 
. : . : . : . : . : . :
rJMSF015F24+ AGCCAACAAACACGGGGTCTCCATTTCAACGCTCGCTGTGAAATACATTCTAGACCAGCC
rJMSF017L22+ AGCCAACAAACACGGGGTCTCCATTTCAACGCTCGCTGTGAAATACATTCTAGA----CC
                      ____________________________________________________________
consensus AGCCAACAAACACGGGGTCTCCATTTCAACGCTCGCTGTGAAATACATTCTAGACCAGCC
 
. : . : . : . : . : . :
rJMSF015F24+ AGCCGTGGCAGGATCAATGGTAGGCGTTAGGCTTGGCCTGTCGGAACATGTCAAGGATTC
rJMSF017L22+ AGCCGTGGCAGGATCAATGGTAGGCGTTAGGCTTGGCCTGTCGGAACATGTCAAGGATTC
                      ____________________________________________________________
consensus AGCCGTGGCAGGATCAATGGTAGGCGTTAGGCTTGGCCTGTCGGAACATGTCAAGGATTC
 
. : . : . : . : . : . :
rJMSF015F24+ AAACGCTGTTTTCTCTCTCGTCCTGGATGAAGAAGATGTGGGTCGTATCCAAGATGTCAC
rJMSF017L22+ AAACGCTGTTTTCTCTCTCGTCCTGGATGAAGAAGATGTGGGTCGTATCCAAGATGTCAC
rJMSF005O14+ TGGATGAAGAAGATGTGGGTCGTATCCAAGATGTCAC
                      ____________________________________________________________
consensus AAACGCTGTTTTCTCTCTCGTCCTGGATGAAGAAGATGTGGGTCGTATCCAAGATGTCAC
 
. : . : . : . : . : . :
rJMSF015F24+ GAGGAAGGGAAGAGATCTTCAGAAAGTGATCGGGGACTGTGGAGACGAATACAGACGTGG
rJMSF017L22+ GAGGAAGGGAAGAGATCTTCAGAAAGTGATCGGGGACTGTGGAGACGAATACAGACGTGG
rJMSF005O14+ GAGGAAGNGAAGAGATCTTCAGAAAGTGATCGGGGACTGTGGAGACGAATACAGACGTGG
                      ____________________________________________________________
consensus GAGGAAGGGAAGAGATCTTCAGAAAGTGATCGGGGACTGTGGAGACGAATACAGACGTGG
 
. : . : . : . : . : . :
rJMSF015F24+ GTAGAGGTATCAGAAATTATGTTTTGGCACAACGTATTGTCTTCATGAACAAATGTTCTA
rJMSF017L22+ GTAGAGGTATCAGAAATTATGTTTTGGCACAACGTATTGTCTTCATGAACAAATGTTCTA
rJMSF005O14+ GTAGAGGTATCAGAAATTATGTTTTGGCACANCGTATTGTCTTCATGAACAAATGTTCTA
                      ____________________________________________________________
consensus GTAGAGGTATCAGAAATTATGTTTTGGCACAACGTATTGTCTTCATGAACAAATGTTCTA
 
. : . : . : . : . : . :
rJMSF015F24+ TGGCAGATACCTTCATATATTGAGTTACAAGCCATTGTTGTTCCATGTCAAGGATTGTAG
rJMSF017L22+ TGGCAGATACCTTCATATATTGAGTTACAAGCCATTGTTGTTCCATGTCAAGGATTGTAG
rJMSF005O14+ TGGCAGATACCTTCATATATTGAGTTACAAGCCATTGTTGTTCCATGTCAAGGATTGTAG
                      ____________________________________________________________
consensus TGGCAGATACCTTCATATATTGAGTTACAAGCCATTGTTGTTCCATGTCAAGGATTGTAG
 
. : . : . : . : . : . :
rJMSF015F24+ ATTTGTAACCTACAAAACTATAGTATACCATAGATG
rJMSF017L22+ ATTTGTAACCTACAAAACTATAGTATACCATAGATGGACTTTGCCACCTATATATATTTC
rJMSF005O14+ ATTTGTNACCTACAAAACTATAGTATACCATAGATGGACTTTGCCACCTATATATATCTC
                      ____________________________________________________________
consensus ATTTGTAACCTACAAAACTATAGTATACCATAGATGGACTTTGCCACCTATATATATTTC
 
. : . : . : . : . : . :
rJMSF017L22+ AAGAGAGT
rJMSF005O14+ AAGAGAGTTCGTAAAATGGGAACAACTCTAGCTAAATTTGTCAGACTATTTAGCATAACG
                      ____________________________________________________________
consensus AAGAGAGTTCGTAAAATGGGAACAACTCTAGCTAAATTTGTCAGACTATTTAGCATAACG